Expand PubMLST Databases Downloads BIGSdb Contact Account

MLST of Xylella fastidiosa

Genes

The MLST for Xylella fastidiosa scheme uses internal fragments of the following seven house-keeping genes:

GeneGene FunctionBiochemical FunctionTemecula (PD0001) Gene PositionM12 (ALS0299) Gene Position9a5c (CVC0018) Gene Postion
leuA2-isopropylmalate synthaseamino acid biosynthesisPD1047Xfasm_1205XF1818
petCubiquinol cytochrome C oxidoreductase, cystochrome C1 subunitelectron transportPD1775Xfasm_1943XF0910
malFABC transporter sugar permeasetransport of carbohydratesPD1465Xfasm12_1606XF2447
cysGsiroheme synthasebiosynthesis of heme, porphyrinPD1840Xfasm12_2018XF0832
holCDNA polymerase III holoenzyme, chi subunitreplicationPD0104Xfasm12_0112XF0136
nuoLNADH-ubiquinone oxidoreductase, NQO12 subunitaerobic respirationPD0259Xfasm12_0280XF0316
gltTglutamate symport proteintransport of amino acidsPD1516Xfasm12_1656XF0656

PCR Primers

The following primers are used for both PCR and sequencing:

GenePrimer SequencesAmplicona Length (bp)
leuAfor - 5' GGTGC ACGCC AAATC GAATG 3'
rev - 5' GTATC GTTGT GGCGT ACACT G 3'
708
petCfor - 5' GCTGC CATTC GTTGA AGTAC CT 3'
rev - 5' GCACG TCCTC CCAAT AAGCC T 3'
533
malFfor - 5' TTGC TGGT CCTG CGGT GTTG 3'
rev - 5' GACAGCAGAAGCACGTCCCAGAT 3'
730
cysGfor - 5' GCCGA AGCAG TGCTG GAA G 3'
rev - 5' GCCAT TTTCG ATCAG TGCAA AAG 3'
600b
holCfor - 5' ATGGC ACGCG CCGAC TTCT 3'
rev - 5' ATGTC GTGTT TGTTC ATGTG CAGG 3'
379
nuoLfor - 5' TAGCG ACTTA CGGTT ACTGG GC 3'
rev - 5' ACCAC CGATC CACAA CGCAT 3'
557c
gltTfor - 5' TCATG ATCCA AATCA CTCGC TT 3'
rev - 5' ACTGG ACGCT GCCTC GTA AA CC 3'
654
a Amplicon length with primers removed.
b A 6bp indel appears in some isolates.
c A 30bp indel appears in some isolates.

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Xylella fastidiosa MLST website (https://pubmlst.org/ fastidiosa/) sited at the University of Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). The development and maintenance of this site has been funded by the Wellcome Trust.

Status

Sequence database
Sequences: 147
Profiles (MLST): 87
Last updated: 2019-03-06

Isolate database
Isolates: 293
Last updated: 2015-09-10