Expand PubMLST Databases Downloads BIGSdb Contact Account

Primers and PCR - protocol for Stenotrophomonas maltophilia MLST

Genes

The MLST scheme of Stenotrophomonas maltophilia uses fragments of the subsequent seven house-keeping genes:

PCR amplification

The primer sequences are shown in the table below. Practical annealing temperatures of primer pairs were determined on a gradient cycler (FlexCycler, Analytik Jena, Jena, Germany). They were used both for sequencing and amplification.

The PCR conditions were as follows: initial activation of the Taq-DNA-Polymerase for 9 min at 95°C, followed by 30 cycles of 20 sec denaturation at 94°C, annealing for 1 min at the appropriate annealing temperature (Ta, see table) and extension for 50 sec at 72°C. The program ended with a 5 min fill in step at 72°C. Two separately generated amplicons for forward and reverse sequencing were purified from unincorporated nucleotides using Exonuclease I / Phosphatase (USB, Staufen, Germany) according to the manufacturer's protocol. The purified template was quantified by using the Nanodrop ND-1000 spectral photometer (Peqlab Biotechnologie GmbH, Erlangen, Germany).

Composition of a 25 µl PCR mixture: 1 µl DNA; 1 µl primer forward (25 µM), 1 µl primer reverse (25 µM), 2 µl DNA Polymerization Mix (Amersham Biosciences; 25 mM each dNTP); 2 µl MgCl2 (Applied Biosystems; 25 mM); 2.5 µl 10x PCR-Buffer II (without MgCl2; Applied Biosystems); 1 µl DMSO; 0.2 µl Taq-DNA-Polymerase (5 U/µl; Ampli Taq Gold, Applied Biosystems); 14.3 µl Aqua ad iniectabilia (Braun Melsungen).

The sequencing reaction was performed with 20 ng DNA and the BigDye Terminator Ready Reaction Mix (v1.1, Applied Biosystems). Cycle sequencing with standard conditions was used for primers with Ta > 60°C. In the case of lower Ta, denaturation for 10 sec at 96°C was followed by annealing at Ta for 10 sec and subsequent elongation for 4 min at 60°C. Unincorporated dye terminators were removed by precipitation with absolute ethanol. The air dried reaction product was resuspended in 20 µl of Hi-Di formamide and loaded, separated and detected on an ABI PRISM 310 genetic analyzer using POP-6 polymer and a 61 cm genetic analysis capillary (Applied Biosystems).

PrimerPrimer Sequence (5' → 3')Ta
atpD forwATGAGTCAGGGCAAGATCGTTC62°C
atpD revTCCTGCAGGACGCCCATTTC
gapA forwTGGCAATCAAGGTTGGTATCAAC62°C
gapA revTTCGCTCTGTGCCTTCACTTC
gapA forw (2fwd)1AGGAGCTTGAGAAATGGCAA48 - 58°C
gapA rev (2r)1GAGTAGCCCCACTCGTTGTC
guaA forwAACGAAGAAAAGCGCTGGTA62°C2
guaA revACGGATGGCGGTAGACCAT
mutM forwAACTGCCCGAAGTCGAAAC58°C, 62°C2
52°C, 48°C2
mutM rev (2r)GAGGATCTCCTTCACCGCATC
mutM rev (4r)3TTACCGGCCTCGCGCAG
nuoD forwTTCGCAACTACACCATGAAC48°C
nuoD revCAGCGCGACTCCTTGTACTT
nuoD forw (2f)4AGGAAATCCGCAACTACACC
nuoD rev (2r)4AGCGCGACTCCTTGTACTTC
ppsA forwCAAGGCGATCCGCATGGTGTATTC62°C
ppsA revCCTTCGTAGATGAA(A/G)CCGGT(A/G)TC
ppsA forw (2f)4TTCACCCTGGACACCGAGT58°C
ppsA rev (2r)4CGAAGTCGAAGGCACGTT
recA forwATGGACGAGAACAAGAAGCGC62°C
recA revGGTGATGACCTGCTTGAACGG

1Utilized if 'gapA forw' and 'gapA rev' didn't work. Ta is depending on taxon.
2Temperature in the presence of 1.3 M betaine.
3Utilized if 'mutM rev (2r)' didn't work.
4Alternative primers for nuoD and ppsA respectively.

Last updated 2010-03-31

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Stenotrophomonas maltophilia MLST website (https://pubmlst.org/ smaltophilia/) sited at the University of Oxford (Jolley et al. Wellcome Open Res 2018, 3:124 [version 1; referees: 2 approved]). The development of this site has been funded by the Wellcome Trust.

Status

Sequence database
Sequences: 1,198
Profiles (MLST): 360
Last updated: 2019-09-03

Isolate database
Isolates: 513
Last updated: 2019-07-22