Expand PubMLST Databases Downloads BIGSdb Contact Account

PCR for Staphylococcus epidermidis MLST

Internal fragments of the seven loci can be amplified by PCR, using the primers listed below and chromosomal DNA as a template. PCR involved an initial denaturation of 95 °C for 3 min; 34 cycles of 95 °C for 30 s, 50 °C for 1 min, and 72 °C for 1 min; and a final extension of 72 °C for 10 min.

Gene and functionPrimerSequences (5'-3')Size of amplicon used for assigning alleles
Shikimate dehydrogenase (aroE)aroE-FCATTGGATTACCTCTTTGTTCAGC420
DNA mismatch repair protein (mutS)mutS-F3GATATAAGAATAAGGGTTGTGAA412
Pyrimidine operon regulatory protein (pyrR)pyr-F2GTTACTAATACTTTTGCTGTGTTT428
Triosephosphate isomerase (tpiA)tpi-F2ATCCAATTAGACGCTTTAGTAAC424
Acetyl coenzyme A acetyltransferase (yqiL)yqiL-F2CACGCATAGTATTAGCTGAAG416

Sequences for each locus must be obtained for both the forward and reverse strands, and must be 100% accurate, since even a single error will alter the allelic number obtained.

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Staphylococcus epidermidis MLST website (https://pubmlst.org/ sepidermidis/) sited at the University of Oxford (Jolley et al. Wellcome Open Res 2018, 3:124 [version 1; referees: 2 approved]). The development of this site has been funded by the Wellcome Trust.


Sequence database
Sequences: 455
Profiles (MLST): 870
Last updated: 2019-04-12

Isolate database
Isolates: 1,415
Last updated: 2019-03-20