Expand PubMLST Databases Downloads BIGSdb Contact Site map

Primers used for MLST of Streptococcus agalactiae

Internal fragments (400-500 bp) of the alcohol dehydrogenase (adhP), phenylalanyl tRNA synthetase (PheS), glutamine transporter protein (atr), glutamine synthetase (glnA), serine dehydratase (sdhA), glucose kinase (glcK) and transketolase (tkt) genes are sequenced.

Oligonucleotide primers for GBS MLST

Locus Forward (5' to 3') Reverse (5' to 3') Amplicon size (bp)
adhP amplification GTTGGTCATGGTGAAGCACT ACTGTACCTCCAGCACGAAC 672
sequencing GGTGTGTGCCATACTGATTT ACAGCAGTCACAACCACTCC 498
pheS amplification GATTAAGGAGTAGTGGCACG TTGAGATCGCCCATTGAAAT 723
sequencing ATATCAACTCAAGAAAAGCT TGATGGAATTGATGGCTATG 501
atr amplification CGATTCTCTCAGCTTTGTTA AAGAAATCTCTTGTGCGGAT 627
sequencing ATGGTTGAGCCAATTATTTC CCTTGCTCAACAATAATGCC 501
glnA amplification CCGGCTACAGATGAACAATT CTGATAATTGCCATTCCACG 589
sequencing AATAAAGCAATGTTTGATGG GCATTGTTCCCTTCATTATC 498
sdhA amplification AGAGCAAGCTAATAGCCAAC ATATCAGCAGCAACAAGTGC 646
sequencing AACATAGCAGAGCTCATGAT GGGACTTCAACTAAACCTGC 519
glcK amplification CTCGGAGGAACGACCATTAA CTTGTAACAGTATCACCGTT 607
sequencing GGTATCTTGACGCTTGAGGG ATCGCTGCTTTAATGGCAGA 459
tkt amplification CCAGGCTTTGATTTAGTTGA AATAGCTTGTTGGCTTGAAA 859
sequencing ACACTTCATGGTGATGGTTG TGACCTAGGTCATGAGCTTT 480

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Streptococcus agalactiae MLST website (https://pubmlst.org/ sagalactiae/) sited at the University of Oxford (Jolley & Maiden 2010, BMC Bioinformatics, 11:595). The development of this site has been funded by the Wellcome Trust.

Status

Sequence database
Sequences: 67190
Profiles (MLST): 1145
Last updated: 2017-05-25

Isolate database
Isolates: 2885
Last updated: 2017-05-25