Expand PubMLST Databases Downloads BIGSdb Contact Account

Neisseria FetA Typing

PCR

The variable region can be amplified using primers S1 and S8.  This produces a product of ~1200 bp.

S1 CGGCGCAAGCGTATTCGG
S8 CGCGCCCAATTCGTAACCGTG

Reaction conditions: 30 cycles of 94°C for 60s, 55°C for 60s, 72°C for 90s

Sequencing

Sequence using primers S12 and S15.

S12 TTCAACTTCGACAGCCGCCTT
S15 TTGCAGCGCGTCRTACAGGCG

Further details can be found in Thompson et al. 2003 Microbiology 149:1849-58.

Links

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Neisseria Multi Locus Sequence Typing website (https://pubmlst.org/ neisseria/) sited at the University of Oxford (Jolley et al. Wellcome Open Res 2018, 3:124 [version 1; referees: 2 approved]). The development of this site has been funded by the Wellcome Trust and European Union.