Expand PubMLST Databases Downloads BIGSdb Contact Account

Primers and protocols used for amplification and sequencing - Mannheimia haemolytica MLST

Genes

The MLST scheme for Mannheimia haemolytica uses internal gene fragments of the following seven house-keeping genes:

Primers

Primer used for amplification and sequencing of the housekeeping genes. PCR amplicon sizes and sizes of fragments used for MLST analysis are indicated.

GenePrimer sequence (5' to 3')Size (bp)
Amplicon/MLST
ForwardReverse
adkGCAAAGGTACGCAAGCTCAGAAAATTTTCGCTAACTCAGCAC604/495
aroEGCTTCTGGAGCAAAAGGTTGCCTGTCCAACCAACATTCCT580/486
deoDTCCACACATTAACGCACCTGGCTCCATACTCTGCCGCTAC576/471
gapDHCCGTATCGGTCGTATCGTTTTTTTGCGTTGCAGTAGTTGC519/387
gndGTGATTGGACTCGCCGTAATTTCGATACCGTTGTGAACCA551/438
mdhAGTAACCGGTTTTGCAGGTGGCTTTTGCCTCAACCACTTC503/408
zwfTGATGAAGTCGCAAAAGTGCACGGTTTTCGCCATACTTTG671/501

PCR protocol

DNA was purified from overnight cultures grown in BHI using DNeasy Blood & Tissue Kit (Qiagen). PCR was carried out in 25 µl reaction mixture, using PCR Master (Roche Diagnostics), containing 3 mM MgCl2. Primer concentration was 0.8µM for each primer. Included in the reaction was 2 µl of purified DNA. Cycling conditions were 5 min denaturation at 96 °C, followed by 30 cycles at 96 °C for 30 s, 55 °C for 30s and 72 °C for 1 min. The run was ended with a final extension step at 72 °C for 10 min. Residual dNTPs and primers were removed by mixing 10 µl PCR mixture with 1 µl exonuclease I and 2 µl calf intestine alkaline phophatase (Fermentas). The samples were incubated for 15 min at 37 °C and subsequently at 85 °C to stop the enzymatic reaction. The purified PCR products were sequenced on both strands by Macrogen (Seoul, Korea) using the PCR primers. Sequencing was conducted under BigDyeTM terminator cycling conditions and products purified using ethanol precipitation and run using automatic sequencer ABI3730XL.

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Mannheimia haemolytica MLST website (https://pubmlst.org/ mhaemolytica/) sited at the University of Oxford (Jolley et al. 2004, BMC Bioinformatics, 5:86). The development of this site has been funded by the Wellcome Trust.

Status

Profile database

Profiles: 51
Last updated: 2018-08-14

Isolate database

Isolates: 147
Last updated: 2018-08-14