Expand PubMLST Databases Downloads BIGSdb Contact Site map

Primers used for MLST of Helicobacter pylori

Genes

The Helicobacter MLST scheme uses internal fragments of the following seven house-keeping genes:

atpA, efp, mutY, ppa, trpC, ureI, yphC

Primers

The primer pairs we use for the PCR amplification of internal fragments of these genes are:

Number Name Gene Sequence
O_1369 HptrpC1_for trpC CAAGCTCCTAGAAGTCTCTG
O_1370 HptrpC6_for trpC TAGAATGCAAAAAAGCATCGCCCTC
O_1371 HptrpC5_rev trpC CCCAGCTAGCATGAAAGG
O_1372 HptrpC7_rev trpC TAAGCCCGCACACTTTATTTTCGCC
O_1379 yphCF1_for yphC CACTATTACCACGCCTATTTTTTTGAC
O_1382 yphCR5_rev yphC TTTCTARGCTTTCTAAAATATC
O_1493 HPvacA-4 vacA ATACGCTCCCACGTATTGC
O_1514 OLHPVacA-3(+) vacA ACAACCGTGATCATTCCAGC
O_1958 vacA_for2 vacA CTGCTGTAGGAACGGTCTC
O_1959 vacA_rev2 vacA GCGTGGCGCCATCATAAAGAG
O_1960 yphC_for2 yphC CACGCCTATTTTTTTGACTAAAAAC
O_1961 yphC_rev2 yphC GCGTTTAAGAGCGARCTTTTGC
O_1962 yphC_for3 yphC GCTTTAAATAACTATAATATTGTAATC
O_1963 yphC_rev3 yphC CATTYACCCTCCCAATGATGC
O_1964 atpA_for2 atpA GGACTAGCGTTAAACGCACG
O_1965 atpA_rev2 atpA CTTGAAACCGACAAGCCCAC
O_1966 atpA_for3 atpA GTTCCTGTTGGCGATGCGGT
O_1967 atpA_rev3 atpA CCTGAATAAAACAAATCCGTTTC
O_1979 mutY_for2 mutY GTGGTTGTAGYTGGAAACTTTACAC
O_1980 mutY_rev2 mutY CAACGCCCAAGTAACGCTCTTC
O_1981 mutY_for3 mutY GGAATTTAAAGGGCATTAACGCC
O_1982 mutY_rev3 mutY CTTAAGCGTGTGTYTTTCTAGG
O_2044 efp_for1 efp GGCAATTTGGATGAGCGAGCTC
O_2045 efp_rev1 efp CTTCACCTTTTCAAGATACTC
O_2046 efp_for2 efp GGGCTTGAAAATTGAATTGGGCGG
O_2047 efp_rev2 efp GTATTGACTTTAATGATCTCACCC
O_2201 ppa_for1 ppa GGAGTGAGCCATGACGCTGA
O_2204 ppa_rev2 ppa GCTTTTATSGCTTTYTCTAAAAC
O_2356 ureIfor ureI AGGTTATTCGTAAGGTGCG
O_2357 atpAinternal-for atpA internal GCTATTGGGCAAAAAGAATC
O_2358 atpAinternal-rev atpA internal ACGACGCTGTATTCCATCGC
O_3151 ureI-rev2 ureI GTTTAAATCCCTTAGATTGCC
O_3152 ureI-rev3 ureI GAAATCCAAGGGGTTTAAATC
O_3225 yphC-for3 yphC GACCCTTATTTAAGCTTTAAATAAC
O_3226 yphC-rev3 yphC CCCAATGATGCCTACTTGAAT
O_3237 ppa-for4 ppa CAATGAATTTAGACCAATTAGAAGT
O_3238 ppa-for5 ppa GGAGATTGCAATGAATTTAGA
O_3239 ppa-for6 ppa TTCAAAGGAGATTGCAATGAATT
O_3240 ppa-rev4 ppa GGGTTAARATCGTTAAATTGTAG
O_3241 ppa-rev5 ppa GTGGGGTTAARATCGTTAAATTG
O_3242 ureI-for4 ureI CTTTATGATTRGCTCAAGCAAC
O_3243 ureI-for5 ureI GCTCAAGCAACAAARGTTATTCG

Primer combinations

Amplification Sequencing
Gene fragment for rev for rev
atpA O_1964 O_1965 O_1964 O_1965
internal atpA O_2357 O_2358
efp O_2044 O_2045 O_2044 O_2045
mutY O_1979 O_1982 O_1979 O_1982
ppa O_3238 O_3241 O_3238 O_3241
trpC O_1370 O_1372 O_1370 O_1372
ureI O_2356 O_3151 O_2356 O_3151
yphC O_1960 O_1963 O_1960 O_1963
vacA O_1514 O_1493 O_1514 O_1493

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Helicobacter pylori Multi Locus Sequence Typing website (https://pubmlst.org/ helicobacter/) developed by Keith Jolley and sited at the University of Oxford (Jolley & Maiden 2010, BMC Bioinformatics, 11:595). The development of this site has been funded by the Wellcome Trust and European Union.

Status

Sequence database
Sequences: 19937
Profiles (MLST): 3262
Last updated: 2017-12-13

Isolate database
Isolates: 2225
Last updated: 2016-12-07