Expand PubMLST Databases Downloads BIGSdb Contact Account

Primers used for MLST of Campylobacter lari

Genes

The Campylobacter lari MLST scheme uses internal fragments of the following seven house-keeping genes:

adk (adenylate kinase)
atpA (ATP synthase alpha subunit)
glnA (glutamine synthetase)
glyA (serine hydroxy methyl transferase)
pgi (glucose-6-phosphate isomerase)
pgm (phospho glucomutase)
tkt (transketolase)

PCR Amplification and sequencing

The primer pairs used for the PCR amplification and sequencing are detailed below:

adk
Forward
adkF: TGAAAGAATTRTTTTTAATCATAGG
Reverse
adkR: CTTTCATRTCWGCHACGATAGGTTC

atpA
Forward
atpAF: GWCAAGGDGTTATYTGTATWTATGTTGC
Reverse
atpAR: TTTAADAVYTCAACCATTCTTTGTCC

glnA
Forward
glnAF: TGATAGGMACTTGGCAYCATATYAC
Reverse
glnAR: ARRCTCATATGMACATGCATACCA

glyA
Forward
glyAF: ATTCAGGTTCTCAAGCTAATCAAGG
Reverse
glyAR: GCTAAATCYGCATCTTTKCCRCTAAA

pgi
Forward
pgiF1: TAGTGGGWATGGGAGGDTCAAGTT
Reverse
pgiR1: CCAATDAGWGCDATAGGAGTTAAACC

pgm
Forward
pgmF3: CGTGTTGTTTTAGATGTGGCTCA
Reverse
pgmR3: ATAGCGAAACAAACTAGCAATTCCT

tkt
Forward
tktF2: GCCTTTGGGTTTAGCRGATATTATG
Reverse
tktR: TTTTAATHAVHTCTTCRCCCAAAGGT

Reaction conditions - PCR

Denaturation: 94ºC 30 s
Annealing: 53ºC 30 s
Extension: 72ºC 2 minutes
30 cycles

Links

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Campylobacter Multi Locus Sequence Typing website (https://pubmlst.org/ campylobacter/) sited at the University of Oxford (Jolley et al. Wellcome Open Res 2018, 3:124 [version 1; referees: 2 approved]). The development of this site has been funded by the Wellcome Trust.