Expand PubMLST Databases Downloads BIGSdb Contact Account

Primers used for MLST of Campylobacter insulaenigrae

Genes

The Campylobacter insulaenigrae MLST scheme uses internal fragments of the following seven house-keeping genes:

aspA (aspartase)
atpA (ATP synthase alpha subunit)
glnA (glutamine synthetase)
glyA (serine hydroxy methyl transferase)
pgi (glucose-6-phosphate isomerase)
pgm (phospho glucomutase)
tkt (transketolase)

PCR Amplification and sequencing

The primer pairs used for the PCR amplification and sequencing are detailed below:

aspA
Forward
aspAF2: GAAGCWAAAGCWAAAGAATAYAAAGAT
Reverse
aspAR2: GAGTTTTTTGCAWGCTTCWGGATT

atpA
Forward
atpAF: GWCAAGGDGTTATYTGTATWTATGTTGC
Reverse
atpAR: TTTAADAVYTCAACCATTCTTTGTCC

glnA
Forward
glnAF: TGATAGGMACTTGGCAYCATATYAC
Reverse
glnAR: ARRCTCATATGMACATGCATACCA

glyA
Forward
insglyF1: GCTTTTTAATTGTMYTTTTGCTAATGT
Reverse
insglyR1: GCTARATCTGCATCTTTRCCRCTAAA

pgi
Forward
inspgiF: GTTTTAGTAGGTATGGGTGGATCAAGC
Reverse
inspgiR: TATTTGGAATCAAAGGAGCTTTATAGC

pgm
Forward
inspgmF2: AATTCTTTCCCTAAAAATTTAACTCTT
Reverse
inspgmR2: AGTAAGCGAATTAAATTTTYAGTTCCT

tkt
Forward
tktF1: GCAAAYTCAGGMCAYCCAGGTGC
Reverse
instktR1: TTTACATCTTCAGGAATTTCAAAAGTT

Links

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Campylobacter Multi Locus Sequence Typing website (https://pubmlst.org/ campylobacter/) sited at the University of Oxford (Jolley et al. Wellcome Open Res 2018, 3:124 [version 1; referees: 2 approved]). The development of this site has been funded by the Wellcome Trust.