Expand PubMLST Databases Downloads BIGSdb Contact Account

Primers used for MLST of Campylobacter helveticus

Genes

The Campylobacter helveticus MLST scheme uses internal fragments of the following seven house-keeping genes:

aspA (aspartase)
atpA (ATP synthase alpha subunit)
glnA (glutamine synthetase)
gltA (citrate synthase)
glyA (serine hydroxy methyl transferase)
pgm (phospho glucomutase)
tkt (transketolase)

PCR Amplification and sequencing

The primer pairs used for the PCR amplification and sequencing are detailed below:

aspA
Forward
aspAF2: GAAGCWAAAGCWAAAGAATAYAAAGAT
Reverse
aspAR2: GAGTTTTTTGCAWGCTTCWGGATT

atpA
Forward
atpAF: GWCAAGGDGTTATYTGTATWTATGTTGC
Reverse
atpAR: TTTAADAVYTCAACCATTCTTTGTCC

glnA
Forward
glnAF: TGATAGGMACTTGGCAYCATATYAC
Reverse
glnAR: ARRCTCATATGMACATGCATACCA

gltA
Forward
gltAF: GARTGGCTTGCKGAAAAYAARCTTT
Reverse
gltAR: TATAAACCCTATGYCCAAAGCCCAT

glyA
Forward
glyAF: ATTCAGGTTCTCAAGCTAATCAAGG
Reverse
glyAR: GCTAAATCYGCATCTTTKCCRCTAAA

pgm
Forward
pgmF2: ATGTGGCWCAYGGAGCRGCTTATAA
Reverse
pgmR2: GGCTATTRATRCCCTTTTTATCAAG

tkt
Forward
tktF1: GCAAAYTCAGGMCAYCCAGGTGC
Reverse
tktR: TTTTAATHAVHTCTTCRCCCAAAGGT

Reaction conditions - PCR

Denaturation: 94ºC 30 s
Annealing: 53ºC 30 s
Extension: 72ºC 2 minutes
30 cycles

Links

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Campylobacter Multi Locus Sequence Typing website (https://pubmlst.org/ campylobacter/) sited at the University of Oxford (Jolley et al. Wellcome Open Res 2018, 3:124 [version 1; referees: 2 approved]). The development of this site has been funded by the Wellcome Trust.