Expand PubMLST Databases Downloads BIGSdb Contact Account

Primers used for MLST of Bordetella

Genes

The Bordetella MLST scheme uses internal fragments of the following seven house-keeping genes:

GeneBB ORFBPP ORFBP ORF
adk (Adenylate kinase)BB2005BPP2560BP2769
fumC (fumarate hydratase class II)BB4054BPP3619BP0248
glyA (serine hydroxymethyltransferase)BB4348BPP3875BP2952
tyrB (aromatic amino-acid aminotransferase)BB2272BPP2024BP1795
icd (isocitrate dehyrogenase)BB3924BPP3475BP2488
pepA (cytosol aminopeptidase)BB3736BPP3285BP2421
pgm (phosphoglucomutase)BB0885BPP0800BP3141

PCR Amplification

The PCR conditions were optimized using HotStar Taq mastermix (Qiagen) and 1M betaine final concentration. The cycling conditions were as follows:

95°C for 15 min
30 cycles of:
95°C for 30 s
54°C for 30 s
72°C for 1 min

Primers

Primer nameSequence
Adk-FAGCCGCCTTTCTCACCCAACACT
Adk-RTGGGCCCAGGACGAGTAGT
FumC-FCGTGAACCGGGGCCAGTCGTC
FumC-RGGCCAGCCAGCGCACATCGTT
GlyA-FCAACCAGGGCGTGTACATGGC
GlyA-RCCGCGATGACGTGCATCAG
TyrB-FCGAGACCTACGCTTATTACGAT
TyrB-RTGCCGGCCAGTTCATTTT
Icd-FCTGGTCCACAAGGGCAACAT
Icd-RACACCTGGGTGGCGCCTTC
PepA-FCGCCCCAGGTTGAAGAAAATCGTC
PepA-RATCAGGCCCACCACATCCAG
Pgm-FCGCCCATGTCACCAGCACCGA
Pgm-RCGCCGTCTATCGTAACCAG

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Bordetella Multi Locus Sequence Typing website (https://pubmlst.org/ bordetella/) sited at the University of Oxford (Jolley et al. Wellcome Open Res 2018, 3:124 [version 1; referees: 2 approved]). The development of this site has been funded by the Wellcome Trust.

Status

Sequence database
Sequences: 36,821
Profiles (MLST): 96
Last updated: 2020-02-07

Isolate database
Isolates: 1,734
Last updated: 2020-02-11