PubMLST Database home Contents
Log in
Help

thrA allele sequence: id-2345

Contig position

sequence bin id
42309
contig length
151176
start
110791
end
111126
length
336
orientation
forward
complete
yes
method
Illumina
Options

Sequence

ATTAATTAAG TATTACAGAG AATATGTTGA TGGGAAAGAT GTAACAGCAA GCCAAGAGTG GATTATCAAC CGTTACCAGG CAATGGTCGA TGAACTCGGT TTTTCAGCTA ATAGCATGAA GAAAATTGCT GAAAACATCA TTTCTCTTGC AACCTTACCA ATTGATGATA ACGAATTCCT TTACGATACT TTTTTAGCCG CTGGGGAAGA TAACAATGCA AAATTAATCG CTGAATACTT TACTTTTAGA GGATTACCAG CACGCTATGT TCATCCGAAA AAGGCTGGCA TTATTGTAAG TTCTGAACCA GGAAATGCAC GAATTCTTCC TTCGAGCTAT GATAAAATTG AAGAATTGCG AAATGCAGAG GAAGTCTTGA TCATCCCTGG ATTCTTTGGA GTGACTATTG ACAATCAAAT TTGTACCTTC TCACGGGGAG GATCTGATAT CACAGGATCC ATCGTTGCTG CAGGGGTTAA GGCAGATCTG TATGAAAACT TTACAGATGT AGATGGGATT TTTGCTGCTC ACCCTG

Translation


          I  N  *  V  L  Q  R  I  C  *  W  E  R  C  N  S  K  P  R  V  D  Y  Q  P  L  P  G  N  G  R  *  T  R  F   F1
           L  I  K  Y  Y  R  E  Y  V  D  G  K  D  V  T  A  S  Q  E  W  I  I  N  R  Y  Q  A  M  V  D  E  L  G     F2
            *  L  S  I  T  E  N  M  L  M  G  K  M  *  Q  Q  A  K  S  G  L  S  T  V  T  R  Q  W  S  M  N  S  V    F3
        1 ATTAATTAAGTATTACAGAGAATATGTTGATGGGAAAGATGTAACAGCAAGCCAAGAGTGGATTATCAACCGTTACCAGGCAATGGTCGATGAACTCGGT 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            F  S  *  *  H  E  E  N  C  *  K  H  H  F  S  C  N  L  T  N  *  *  *  R  I  P  L  R  Y  F  F  S  R    F1
          F  S  A  N  S  M  K  K  I  A  E  N  I  I  S  L  A  T  L  P  I  D  D  N  E  F  L  Y  D  T  F  L  A  A   F2
           F  Q  L  I  A  *  R  K  L  L  K  T  S  F  L  L  Q  P  Y  Q  L  M  I  T  N  S  F  T  I  L  F  *  P     F3
      101 TTTTCAGCTAATAGCATGAAGAAAATTGCTGAAAACATCATTTCTCTTGCAACCTTACCAATTGATGATAACGAATTCCTTTACGATACTTTTTTAGCCG 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           W  G  R  *  Q  C  K  I  N  R  *  I  L  Y  F  *  R  I  T  S  T  L  C  S  S  E  K  G  W  H  Y  C  K     F1
            G  E  D  N  N  A  K  L  I  A  E  Y  F  T  F  R  G  L  P  A  R  Y  V  H  P  K  K  A  G  I  I  V  S    F2
          L  G  K  I  T  M  Q  N  *  S  L  N  T  L  L  L  E  D  Y  Q  H  A  M  F  I  R  K  R  L  A  L  L  *  V   F3
      201 CTGGGGAAGATAACAATGCAAAATTAATCGCTGAATACTTTACTTTTAGAGGATTACCAGCACGCTATGTTCATCCGAAAAAGGCTGGCATTATTGTAAG 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          F  *  T  R  K  C  T  N  S  S  F  E  L  *  *  N  *  R  I  A  K  C  R  G  S  L  D  H  P  W  I  L  W  S   F1
           S  E  P  G  N  A  R  I  L  P  S  S  Y  D  K  I  E  E  L  R  N  A  E  E  V  L  I  I  P  G  F  F  G     F2
            L  N  Q  E  M  H  E  F  F  L  R  A  M  I  K  L  K  N  C  E  M  Q  R  K  S  *  S  S  L  D  S  L  E    F3
      301 TTCTGAACCAGGAAATGCACGAATTCTTCCTTCGAGCTATGATAAAATTGAAGAATTGCGAAATGCAGAGGAAGTCTTGATCATCCCTGGATTCTTTGGA 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            D  Y  *  Q  S  N  L  Y  L  L  T  G  R  I  *  Y  H  R  I  H  R  C  C  R  G  *  G  R  S  V  *  K  L    F1
          V  T  I  D  N  Q  I  C  T  F  S  R  G  G  S  D  I  T  G  S  I  V  A  A  G  V  K  A  D  L  Y  E  N  F   F2
           *  L  L  T  I  K  F  V  P  S  H  G  E  D  L  I  S  Q  D  P  S  L  L  Q  G  L  R  Q  I  C  M  K  T     F3
      401 GTGACTATTGACAATCAAATTTGTACCTTCTCACGGGGAGGATCTGATATCACAGGATCCATCGTTGCTGCAGGGGTTAAGGCAGATCTGTATGAAAACT 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           Y  R  C  R  W  D  F  C  C  S  P  X                                                                    F1
            T  D  V  D  G  I  F  A  A  H  P  X                                                                   F2
          L  Q  M  *  M  G  F  L  L  L  T  L                                                                     F3
      501 TTACAGATGTAGATGGGATTTTTGCTGCTCACCCTG 536
          ----:----|----:----|----:----|----:-