PubMLST Database home Contents
Log in
Help

recA allele sequence: id-2345

Contig position

sequence bin id
42321
contig length
65102
start
9373
end
9726
length
354
orientation
reverse
complete
yes
method
Illumina
Options

Sequence

TGTACCTCGT GCAGAAATTG ATGGTGATAT TGGTGATAGT CACGTAGGTT TGCAAGCACG CATGATGAGT CAGGCTATGC GTAAGTTGTC AGCTTCTATC AACAAGACCA AGACAATTGC TATCTTTATC AACCAGTTAC GTGAAAAAGT TGGGGTGATG TTTGGTAACC CTGAAACAAC ACCTGGTGGA CGTGCTCTTA AGTTCTATGC ATCTGTTCGT ATGGATGTCC GCGGAAATAC GCAGATCAAA GGTACTGGCG ATCAAAAAGA TCAAAACGTT GGTAAGGAAA CCAAGGTCAA GATTGTGAAG AATAAGGTAG CTCCTCCGTT TAAGGAAGCT GTCGTTGAAA TCATGTATGG AGAGGGAATT TCTCGCACAG GTGAATTAAT CGAGATCGGT AGCAACCTTG GTATTATTCA AAAAGCAGGT GCCTGGTATT CTTATAATGG AGAAAAAATC GGACAAGGCT CTGAAAATGC TAAGAAATTC TTGGCAGACA ATCCAGCAAT CTTTGATGAA ATCGACCGTA AGATTCGTAT TCACTATGGT TTGA

Translation


          C  T  S  C  R  N  *  W  *  Y  W  *  *  S  R  R  F  A  S  T  H  D  E  S  G  Y  A  *  V  V  S  F  Y  Q   F1
           V  P  R  A  E  I  D  G  D  I  G  D  S  H  V  G  L  Q  A  R  M  M  S  Q  A  M  R  K  L  S  A  S  I     F2
            Y  L  V  Q  K  L  M  V  I  L  V  I  V  T  *  V  C  K  H  A  *  *  V  R  L  C  V  S  C  Q  L  L  S    F3
        1 TGTACCTCGTGCAGAAATTGATGGTGATATTGGTGATAGTCACGTAGGTTTGCAAGCACGCATGATGAGTCAGGCTATGCGTAAGTTGTCAGCTTCTATC 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            Q  D  Q  D  N  C  Y  L  Y  Q  P  V  T  *  K  S  W  G  D  V  W  *  P  *  N  N  T  W  W  T  C  S  *    F1
          N  K  T  K  T  I  A  I  F  I  N  Q  L  R  E  K  V  G  V  M  F  G  N  P  E  T  T  P  G  G  R  A  L  K   F2
           T  R  P  R  Q  L  L  S  L  S  T  S  Y  V  K  K  L  G  *  C  L  V  T  L  K  Q  H  L  V  D  V  L  L     F3
      101 AACAAGACCAAGACAATTGCTATCTTTATCAACCAGTTACGTGAAAAAGTTGGGGTGATGTTTGGTAACCCTGAAACAACACCTGGTGGACGTGCTCTTA 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           V  L  C  I  C  S  Y  G  C  P  R  K  Y  A  D  Q  R  Y  W  R  S  K  R  S  K  R  W  *  G  N  Q  G  Q     F1
            F  Y  A  S  V  R  M  D  V  R  G  N  T  Q  I  K  G  T  G  D  Q  K  D  Q  N  V  G  K  E  T  K  V  K    F2
          S  S  M  H  L  F  V  W  M  S  A  E  I  R  R  S  K  V  L  A  I  K  K  I  K  T  L  V  R  K  P  R  S  R   F3
      201 AGTTCTATGCATCTGTTCGTATGGATGTCCGCGGAAATACGCAGATCAAAGGTACTGGCGATCAAAAAGATCAAAACGTTGGTAAGGAAACCAAGGTCAA 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          D  C  E  E  *  G  S  S  S  V  *  G  S  C  R  *  N  H  V  W  R  G  N  F  S  H  R  *  I  N  R  D  R  *   F1
           I  V  K  N  K  V  A  P  P  F  K  E  A  V  V  E  I  M  Y  G  E  G  I  S  R  T  G  E  L  I  E  I  G     F2
            L  *  R  I  R  *  L  L  R  L  R  K  L  S  L  K  S  C  M  E  R  E  F  L  A  Q  V  N  *  S  R  S  V    F3
      301 GATTGTGAAGAATAAGGTAGCTCCTCCGTTTAAGGAAGCTGTCGTTGAAATCATGTATGGAGAGGGAATTTCTCGCACAGGTGAATTAATCGAGATCGGT 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            Q  P  W  Y  Y  S  K  S  R  C  L  V  F  L  *  W  R  K  N  R  T  R  L  *  K  C  *  E  I  L  G  R  Q    F1
          S  N  L  G  I  I  Q  K  A  G  A  W  Y  S  Y  N  G  E  K  I  G  Q  G  S  E  N  A  K  K  F  L  A  D  N   F2
           A  T  L  V  L  F  K  K  Q  V  P  G  I  L  I  M  E  K  K  S  D  K  A  L  K  M  L  R  N  S  W  Q  T     F3
      401 AGCAACCTTGGTATTATTCAAAAAGCAGGTGCCTGGTATTCTTATAATGGAGAAAAAATCGGACAAGGCTCTGAAAATGCTAAGAAATTCTTGGCAGACA 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           S  S  N  L  *  *  N  R  P  *  D  S  Y  S  L  W  F  X                                                  F1
            P  A  I  F  D  E  I  D  R  K  I  R  I  H  Y  G  L  X                                                 F2
          I  Q  Q  S  L  M  K  S  T  V  R  F  V  F  T  M  V  *                                                   F3
      501 ATCCAGCAATCTTTGATGAAATCGACCGTAAGATTCGTATTCACTATGGTTTGA 554
          ----:----|----:----|----:----|----:----|----:----|----