PubMLST Database home Contents
Log in
Help

mutS allele sequence: id-2345

Contig position

sequence bin id
42330
contig length
119199
start
86101
end
86439
length
339
orientation
forward
complete
yes
method
Illumina
Options

Sequence

GGCTGTTGGA GTTGTTAAAC GTGAAGTGGT GCAAGTCATC ACTCCAGGCA CAGTGACCGA TTCATCAAAG ATGGGAGCCG ACAGTAACTA TTTGGTTGCG ATTGACCGTC AGGGAGTGCA GTTCGCACTT TCTTATATGG ATGTATCAAC AGGTCAGTTT TTTGTGACTA GTTTGGATGA TTTTACCAGT CTTTGCGGTG AAATCCGCAA TTTACGGGCA CGTGAATTGG TCATCGGCTA TGCTCTGTCG GAGGAAGAGG AGCAGGTTTT CTCTAATCAG ATGAACTTGT TGCTCTCTTT TGAAGATGAG GTGACAGAGG ATGTCCAATT GATTGATAAT TCCTTGACAG ACTTGGAGAA AGCTGCAGCA GGCAAGCTTC TCAGCTACCT TCATAGGACT CAGATGCGGG ATTTGGTCCA TTTGCAAAAA GTGGTTCACT ATGAAATCAA GGACTATCTG CAAATGGACT ATGCAACCAA GTCCAGTCTG GACCTGCTTG AAAACGGTCG GACAGGCAAG AAGCACGGTA GTTTGTACT

Translation


          G  C  W  S  C  *  T  *  S  G  A  S  H  H  S  R  H  S  D  R  F  I  K  D  G  S  R  Q  *  L  F  G  C  D   F1
           A  V  G  V  V  K  R  E  V  V  Q  V  I  T  P  G  T  V  T  D  S  S  K  M  G  A  D  S  N  Y  L  V  A     F2
            L  L  E  L  L  N  V  K  W  C  K  S  S  L  Q  A  Q  *  P  I  H  Q  R  W  E  P  T  V  T  I  W  L  R    F3
        1 GGCTGTTGGAGTTGTTAAACGTGAAGTGGTGCAAGTCATCACTCCAGGCACAGTGACCGATTCATCAAAGATGGGAGCCGACAGTAACTATTTGGTTGCG 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            *  P  S  G  S  A  V  R  T  F  L  Y  G  C  I  N  R  S  V  F  C  D  *  F  G  *  F  Y  Q  S  L  R  *    F1
          I  D  R  Q  G  V  Q  F  A  L  S  Y  M  D  V  S  T  G  Q  F  F  V  T  S  L  D  D  F  T  S  L  C  G  E   F2
           L  T  V  R  E  C  S  S  H  F  L  I  W  M  Y  Q  Q  V  S  F  L  *  L  V  W  M  I  L  P  V  F  A  V     F3
      101 ATTGACCGTCAGGGAGTGCAGTTCGCACTTTCTTATATGGATGTATCAACAGGTCAGTTTTTTGTGACTAGTTTGGATGATTTTACCAGTCTTTGCGGTG 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           N  P  Q  F  T  G  T  *  I  G  H  R  L  C  S  V  G  G  R  G  A  G  F  L  *  S  D  E  L  V  A  L  F     F1
            I  R  N  L  R  A  R  E  L  V  I  G  Y  A  L  S  E  E  E  E  Q  V  F  S  N  Q  M  N  L  L  L  S  F    F2
          K  S  A  I  Y  G  H  V  N  W  S  S  A  M  L  C  R  R  K  R  S  R  F  S  L  I  R  *  T  C  C  S  L  L   F3
      201 AAATCCGCAATTTACGGGCACGTGAATTGGTCATCGGCTATGCTCTGTCGGAGGAAGAGGAGCAGGTTTTCTCTAATCAGATGAACTTGTTGCTCTCTTT 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          *  R  *  G  D  R  G  C  P  I  D  *  *  F  L  D  R  L  G  E  S  C  S  R  Q  A  S  Q  L  P  S  *  D  S   F1
           E  D  E  V  T  E  D  V  Q  L  I  D  N  S  L  T  D  L  E  K  A  A  A  G  K  L  L  S  Y  L  H  R  T     F2
            K  M  R  *  Q  R  M  S  N  *  L  I  I  P  *  Q  T  W  R  K  L  Q  Q  A  S  F  S  A  T  F  I  G  L    F3
      301 TGAAGATGAGGTGACAGAGGATGTCCAATTGATTGATAATTCCTTGACAGACTTGGAGAAAGCTGCAGCAGGCAAGCTTCTCAGCTACCTTCATAGGACT 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            D  A  G  F  G  P  F  A  K  S  G  S  L  *  N  Q  G  L  S  A  N  G  L  C  N  Q  V  Q  S  G  P  A  *    F1
          Q  M  R  D  L  V  H  L  Q  K  V  V  H  Y  E  I  K  D  Y  L  Q  M  D  Y  A  T  K  S  S  L  D  L  L  E   F2
           R  C  G  I  W  S  I  C  K  K  W  F  T  M  K  S  R  T  I  C  K  W  T  M  Q  P  S  P  V  W  T  C  L     F3
      401 CAGATGCGGGATTTGGTCCATTTGCAAAAAGTGGTTCACTATGAAATCAAGGACTATCTGCAAATGGACTATGCAACCAAGTCCAGTCTGGACCTGCTTG 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           K  R  S  D  R  Q  E  A  R  *  F  V  L                                                                 F1
            N  G  R  T  G  K  K  H  G  S  L  Y  X                                                                F2
          K  T  V  G  Q  A  R  S  T  V  V  C  T                                                                  F3
      501 AAAACGGTCGGACAGGCAAGAAGCACGGTAGTTTGTACT 539
          ----:----|----:----|----:----|----:----