PubMLST Database home Contents
Log in
Help

gki allele sequence: id-2345

Contig position

sequence bin id
42326
contig length
264006
start
59299
end
59619
length
321
orientation
reverse
complete
yes
method
Illumina
Options

Sequence

AGCTGGTACT GTTATCGGTG CCTACAACCT CAATTGGAAA ACCTTGCAAT TAGTTAAAGA TCAGTTTGAA TCTGCCCTCG GCTTACCTTT TTACATTGAT AATGATGCCA ACGTAGCGGC TCTTGGTGAA CAATGGGTTG GTGCAGGAAA TAACAATCCG AATGTTGTCT TCATGACTCT TGGTACAGGT GTCGGTGGCG GTGTCATCGC TGCTGGAAAC TTGATTCGTG GAGTCAAAGG TGCTGGTGGT GAATTGGGCC ATATCACAGT TGACTTTGAT GCACCATTTG CATGTACTTG TGGAAAAAAA GGTTGTTTGG AAACTGTAGC TTCAGCAACA GGTATTGTGA ATTTGACACG CCGTTATGCT GAAGAATACG CAGGTGATGC CAAACTGAAA CAATTGATTG ACGACGGAGA AGAAGTTACT GCAAAAGATG TGTTCGACTT AGCTAAAGAA GGTGACGATT TGGCTTTGAT TGTCTACCGT CACTTCTCAG AATACCTAGG TGTTGCTTGT G

Translation


          S  W  Y  C  Y  R  C  L  Q  P  Q  L  E  N  L  A  I  S  *  R  S  V  *  I  C  P  R  L  T  F  L  H  *  *   F1
           A  G  T  V  I  G  A  Y  N  L  N  W  K  T  L  Q  L  V  K  D  Q  F  E  S  A  L  G  L  P  F  Y  I  D     F2
            L  V  L  L  S  V  P  T  T  S  I  G  K  P  C  N  *  L  K  I  S  L  N  L  P  S  A  Y  L  F  T  L  I    F3
        1 AGCTGGTACTGTTATCGGTGCCTACAACCTCAATTGGAAAACCTTGCAATTAGTTAAAGATCAGTTTGAATCTGCCCTCGGCTTACCTTTTTACATTGAT 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            *  C  Q  R  S  G  S  W  *  T  M  G  W  C  R  K  *  Q  S  E  C  C  L  H  D  S  W  Y  R  C  R  W  R    F1
          N  D  A  N  V  A  A  L  G  E  Q  W  V  G  A  G  N  N  N  P  N  V  V  F  M  T  L  G  T  G  V  G  G  G   F2
           M  M  P  T  *  R  L  L  V  N  N  G  L  V  Q  E  I  T  I  R  M  L  S  S  *  L  L  V  Q  V  S  V  A     F3
      101 AATGATGCCAACGTAGCGGCTCTTGGTGAACAATGGGTTGGTGCAGGAAATAACAATCCGAATGTTGTCTTCATGACTCTTGGTACAGGTGTCGGTGGCG 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           C  H  R  C  W  K  L  D  S  W  S  Q  R  C  W  W  *  I  G  P  Y  H  S  *  L  *  C  T  I  C  M  Y  L     F1
            V  I  A  A  G  N  L  I  R  G  V  K  G  A  G  G  E  L  G  H  I  T  V  D  F  D  A  P  F  A  C  T  C    F2
          V  S  S  L  L  E  T  *  F  V  E  S  K  V  L  V  V  N  W  A  I  S  Q  L  T  L  M  H  H  L  H  V  L  V   F3
      201 GTGTCATCGCTGCTGGAAACTTGATTCGTGGAGTCAAAGGTGCTGGTGGTGAATTGGGCCATATCACAGTTGACTTTGATGCACCATTTGCATGTACTTG 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          W  K  K  R  L  F  G  N  C  S  F  S  N  R  Y  C  E  F  D  T  P  L  C  *  R  I  R  R  *  C  Q  T  E  T   F1
           G  K  K  G  C  L  E  T  V  A  S  A  T  G  I  V  N  L  T  R  R  Y  A  E  E  Y  A  G  D  A  K  L  K     F2
            E  K  K  V  V  W  K  L  *  L  Q  Q  Q  V  L  *  I  *  H  A  V  M  L  K  N  T  Q  V  M  P  N  *  N    F3
      301 TGGAAAAAAAGGTTGTTTGGAAACTGTAGCTTCAGCAACAGGTATTGTGAATTTGACACGCCGTTATGCTGAAGAATACGCAGGTGATGCCAAACTGAAA 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            I  D  *  R  R  R  R  S  Y  C  K  R  C  V  R  L  S  *  R  R  *  R  F  G  F  D  C  L  P  S  L  L  R    F1
          Q  L  I  D  D  G  E  E  V  T  A  K  D  V  F  D  L  A  K  E  G  D  D  L  A  L  I  V  Y  R  H  F  S  E   F2
           N  *  L  T  T  E  K  K  L  L  Q  K  M  C  S  T  *  L  K  K  V  T  I  W  L  *  L  S  T  V  T  S  Q     F3
      401 CAATTGATTGACGACGGAGAAGAAGTTACTGCAAAAGATGTGTTCGACTTAGCTAAAGAAGGTGACGATTTGGCTTTGATTGTCTACCGTCACTTCTCAG 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           I  P  R  C  C  L  X                                                                                   F1
            Y  L  G  V  A  C  X                                                                                  F2
          N  T  *  V  L  L  V                                                                                    F3
      501 AATACCTAGGTGTTGCTTGTG 521
          ----:----|----:----|-