PubMLST Database home Contents
Log in
Help

dpr allele sequence: id-2345

Contig position

sequence bin id
42309
contig length
151176
start
10136
end
10471
length
336
orientation
reverse
complete
yes
method
Illumina
Options

Sequence

ACAGCATTAT TATCAAACTC CAGCAGAAGT TGCAACTCTT TCTCCACGTC AATCTAATTT GTTAGTGGAT TCAAAGGCAG TATTGAACCA AGCAGTCGCT GATTTGTCTG TCGCACATTC AATCCTTCAC CAAGTTCATT GGTACATGCG TGGTCGTGGC TTTATGATTT GGCATCCTAA GATGGATGAG TATATGGACG AAATTGATGG CTATTTGGAT GAGATGAGTG AGCGTTTAAT TACCTTAGGC GGGGCACCGT TTTCTACCCT TAAAGAGTTT AGTGAAAATA GTCAGCTCAA GGAAGTTTCT GGTGATTACA CTGTAACGAT TGAAGAGCAA TTGGCGCGTG TGGTAGAGGT GTTCCGCTAT TTGGCTACTC TTTTCCAAAA GGGATTTGAT GTTAGTGATG AAGAAGGTGA CAGCGTAACC AATGACATTT TCAATGTGGC TAAGGCTAGT ATTGAAAAAC ATATTTGGAT GCTGCAGGCC GAACTTGGTC AAGCACCTAA GTTGTAAATA GTTGAAGGGT CCAATA

Translation


          T  A  L  L  S  N  S  S  R  S  C  N  S  F  S  T  S  I  *  F  V  S  G  F  K  G  S  I  E  P  S  S  R  *   F1
           Q  H  Y  Y  Q  T  P  A  E  V  A  T  L  S  P  R  Q  S  N  L  L  V  D  S  K  A  V  L  N  Q  A  V  A     F2
            S  I  I  I  K  L  Q  Q  K  L  Q  L  F  L  H  V  N  L  I  C  *  W  I  Q  R  Q  Y  *  T  K  Q  S  L    F3
        1 ACAGCATTATTATCAAACTCCAGCAGAAGTTGCAACTCTTTCTCCACGTCAATCTAATTTGTTAGTGGATTCAAAGGCAGTATTGAACCAAGCAGTCGCT 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            F  V  C  R  T  F  N  P  S  P  S  S  L  V  H  A  W  S  W  L  Y  D  L  A  S  *  D  G  *  V  Y  G  R    F1
          D  L  S  V  A  H  S  I  L  H  Q  V  H  W  Y  M  R  G  R  G  F  M  I  W  H  P  K  M  D  E  Y  M  D  E   F2
           I  C  L  S  H  I  Q  S  F  T  K  F  I  G  T  C  V  V  V  A  L  *  F  G  I  L  R  W  M  S  I  W  T     F3
      101 GATTTGTCTGTCGCACATTCAATCCTTCACCAAGTTCATTGGTACATGCGTGGTCGTGGCTTTATGATTTGGCATCCTAAGATGGATGAGTATATGGACG 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           N  *  W  L  F  G  *  D  E  *  A  F  N  Y  L  R  R  G  T  V  F  Y  P  *  R  V  *  *  K  *  S  A  Q     F1
            I  D  G  Y  L  D  E  M  S  E  R  L  I  T  L  G  G  A  P  F  S  T  L  K  E  F  S  E  N  S  Q  L  K    F2
          K  L  M  A  I  W  M  R  *  V  S  V  *  L  P  *  A  G  H  R  F  L  P  L  K  S  L  V  K  I  V  S  S  R   F3
      201 AAATTGATGGCTATTTGGATGAGATGAGTGAGCGTTTAATTACCTTAGGCGGGGCACCGTTTTCTACCCTTAAAGAGTTTAGTGAAAATAGTCAGCTCAA 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          G  S  F  W  *  L  H  C  N  D  *  R  A  I  G  A  C  G  R  G  V  P  L  F  G  Y  S  F  P  K  G  I  *  C   F1
           E  V  S  G  D  Y  T  V  T  I  E  E  Q  L  A  R  V  V  E  V  F  R  Y  L  A  T  L  F  Q  K  G  F  D     F2
            K  F  L  V  I  T  L  *  R  L  K  S  N  W  R  V  W  *  R  C  S  A  I  W  L  L  F  S  K  R  D  L  M    F3
      301 GGAAGTTTCTGGTGATTACACTGTAACGATTGAAGAGCAATTGGCGCGTGTGGTAGAGGTGTTCCGCTATTTGGCTACTCTTTTCCAAAAGGGATTTGAT 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            *  *  *  R  R  *  Q  R  N  Q  *  H  F  Q  C  G  *  G  *  Y  *  K  T  Y  L  D  A  A  G  R  T  W  S    F1
          V  S  D  E  E  G  D  S  V  T  N  D  I  F  N  V  A  K  A  S  I  E  K  H  I  W  M  L  Q  A  E  L  G  Q   F2
           L  V  M  K  K  V  T  A  *  P  M  T  F  S  M  W  L  R  L  V  L  K  N  I  F  G  C  C  R  P  N  L  V     F3
      401 GTTAGTGATGAAGAAGGTGACAGCGTAACCAATGACATTTTCAATGTGGCTAAGGCTAGTATTGAAAAACATATTTGGATGCTGCAGGCCGAACTTGGTC 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           S  T  *  V  V  N  S  *  R  V  Q  X                                                                    F1
            A  P  K  L  *  I  V  E  G  S  N  X                                                                   F2
          K  H  L  S  C  K  *  L  K  G  P  I                                                                     F3
      501 AAGCACCTAAGTTGTAAATAGTTGAAGGGTCCAATA 536
          ----:----|----:----|----:----|----:-