PubMLST Database home Contents
Log in
Help

cpn60 allele sequence: id-2345

Contig position

sequence bin id
42332
contig length
126927
start
92289
end
92606
length
318
orientation
reverse
complete
yes
method
Illumina
Options

Sequence

TGACGGTACA ACAACTGCAA CTGTTTTGAC ACAAGCGATT GTTCGCGAAG GCTTGAAAAA CGTGACTGCA GGTGCCAACC CAATCGGTAT CCGTCGCGGG ATTGAAGCAG CGGTTGCAAC AGCAGTTGAG GCTTTGAAAG CGCAGGCCAA TCCAGTTTCA AATAAAGAAG AAATTGCTCA AGTCGCAGCT GTTTCTTCAC GTTCTGAAAA AGTTGGTGAG TACATTTCAG AAGCTATGGA GCGCGTGGGC ACAGATGGTG TTATCACCAT TGAAGAATCT CGCGGTATGG AAACAGAATT GGATGTGGTT GAAGGTATGC AATTCGACCG TGGTTATCTG TCACAATACA TGGTAACAGA TAATGAAAAG ATGGTGGCTG AACTTGAAAA TCCATTCATC TTGATTACCG ATAAGAAAAT TTCTCATATT CAAGATATTT TGCCACTTTT GGAAAGCATT CTCCAAACCA ATCGTCCATT GTTGATTATT GCTGACGACG TGGATGGGGA AGCCTTAC

Translation


          *  R  Y  N  N  C  N  C  F  D  T  S  D  C  S  R  R  L  E  K  R  D  C  R  C  Q  P  N  R  Y  P  S  R  D   F1
           D  G  T  T  T  A  T  V  L  T  Q  A  I  V  R  E  G  L  K  N  V  T  A  G  A  N  P  I  G  I  R  R  G     F2
            T  V  Q  Q  L  Q  L  F  *  H  K  R  L  F  A  K  A  *  K  T  *  L  Q  V  P  T  Q  S  V  S  V  A  G    F3
        1 TGACGGTACAACAACTGCAACTGTTTTGACACAAGCGATTGTTCGCGAAGGCTTGAAAAACGTGACTGCAGGTGCCAACCCAATCGGTATCCGTCGCGGG 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            *  S  S  G  C  N  S  S  *  G  F  E  S  A  G  Q  S  S  F  K  *  R  R  N  C  S  S  R  S  C  F  F  T    F1
          I  E  A  A  V  A  T  A  V  E  A  L  K  A  Q  A  N  P  V  S  N  K  E  E  I  A  Q  V  A  A  V  S  S  R   F2
           L  K  Q  R  L  Q  Q  Q  L  R  L  *  K  R  R  P  I  Q  F  Q  I  K  K  K  L  L  K  S  Q  L  F  L  H     F3
      101 ATTGAAGCAGCGGTTGCAACAGCAGTTGAGGCTTTGAAAGCGCAGGCCAATCCAGTTTCAAATAAAGAAGAAATTGCTCAAGTCGCAGCTGTTTCTTCAC 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           F  *  K  S  W  *  V  H  F  R  S  Y  G  A  R  G  H  R  W  C  Y  H  H  *  R  I  S  R  Y  G  N  R  I     F1
            S  E  K  V  G  E  Y  I  S  E  A  M  E  R  V  G  T  D  G  V  I  T  I  E  E  S  R  G  M  E  T  E  L    F2
          V  L  K  K  L  V  S  T  F  Q  K  L  W  S  A  W  A  Q  M  V  L  S  P  L  K  N  L  A  V  W  K  Q  N  W   F3
      201 GTTCTGAAAAAGTTGGTGAGTACATTTCAGAAGCTATGGAGCGCGTGGGCACAGATGGTGTTATCACCATTGAAGAATCTCGCGGTATGGAAACAGAATT 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          G  C  G  *  R  Y  A  I  R  P  W  L  S  V  T  I  H  G  N  R  *  *  K  D  G  G  *  T  *  K  S  I  H  L   F1
           D  V  V  E  G  M  Q  F  D  R  G  Y  L  S  Q  Y  M  V  T  D  N  E  K  M  V  A  E  L  E  N  P  F  I     F2
            M  W  L  K  V  C  N  S  T  V  V  I  C  H  N  T  W  *  Q  I  M  K  R  W  W  L  N  L  K  I  H  S  S    F3
      301 GGATGTGGTTGAAGGTATGCAATTCGACCGTGGTTATCTGTCACAATACATGGTAACAGATAATGAAAAGATGGTGGCTGAACTTGAAAATCCATTCATC 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            D  Y  R  *  E  N  F  S  Y  S  R  Y  F  A  T  F  G  K  H  S  P  N  Q  S  S  I  V  D  Y  C  *  R  R    F1
          L  I  T  D  K  K  I  S  H  I  Q  D  I  L  P  L  L  E  S  I  L  Q  T  N  R  P  L  L  I  I  A  D  D  V   F2
           *  L  P  I  R  K  F  L  I  F  K  I  F  C  H  F  W  K  A  F  S  K  P  I  V  H  C  *  L  L  L  T  T     F3
      401 TTGATTACCGATAAGAAAATTTCTCATATTCAAGATATTTTGCCACTTTTGGAAAGCATTCTCCAAACCAATCGTCCATTGTTGATTATTGCTGACGACG 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           G  W  G  S  L  T                                                                                      F1
            D  G  E  A  L  X                                                                                     F2
          W  M  G  K  P  Y                                                                                       F3
      501 TGGATGGGGAAGCCTTAC 518
          ----:----|----:---