PubMLST Database home Contents
Log in
Help

aroA allele sequence: id-2345

Contig position

sequence bin id
42310
contig length
117134
start
103010
end
103375
length
366
orientation
reverse
complete
yes
method
Illumina
Options

Sequence

AATAAAAGGT AGCAAGCATT TAAAACCGAT TCATTACAAA CTTCCTGTAG CCTCAGCTCA AGTTAAGTCA GCTCTGCTAT TTGCTGCCTT ACAGGCAGAA GGAGAATCCA TCATCGTTGA GAAGGAGCTG ACACGAAATC ATACGGAAGA TATGATTGTT CAATTTGGTG GGCAATTGGA TGTTCATGGA AAAGAAATTC GTATTCAAGG TGGTCAGGAA TTTTCAGCGC AAGAAATCAC AGTTCCAGGT GACATTTCAA GTGCAGCATT CTGGTTGGTT GCTGGGTTGG TTGTTCCAGG ATCAAAGATT ACACTAGAAA ATGTTGGTAT TAACGAGACG CGTACAGGAA TTTTAGATGT CATTAAGGCC ATGGGCGGGA AACTGACCTT GTCGAATGTT GATGAACTCG CTAAATCTGC CACCATTACA GTTGAATATT CAGACCTACA TGCCACAGAA ATTGGTGGTG AATTAATTCC ACGTTTAATA GATGAACTGC CTATCATTGC CTTATTAGCA ACTCAAGCAA ATGGTACAAC TGTGATTCGG GATGCTGAAG AACTCA

Translation


          N  K  R  *  Q  A  F  K  T  D  S  L  Q  T  S  C  S  L  S  S  S  *  V  S  S  A  I  C  C  L  T  G  R  R   F1
           I  K  G  S  K  H  L  K  P  I  H  Y  K  L  P  V  A  S  A  Q  V  K  S  A  L  L  F  A  A  L  Q  A  E     F2
            *  K  V  A  S  I  *  N  R  F  I  T  N  F  L  *  P  Q  L  K  L  S  Q  L  C  Y  L  L  P  Y  R  Q  K    F3
        1 AATAAAAGGTAGCAAGCATTTAAAACCGATTCATTACAAACTTCCTGTAGCCTCAGCTCAAGTTAAGTCAGCTCTGCTATTTGCTGCCTTACAGGCAGAA 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            R  I  H  H  R  *  E  G  A  D  T  K  S  Y  G  R  Y  D  C  S  I  W  W  A  I  G  C  S  W  K  R  N  S    F1
          G  E  S  I  I  V  E  K  E  L  T  R  N  H  T  E  D  M  I  V  Q  F  G  G  Q  L  D  V  H  G  K  E  I  R   F2
           E  N  P  S  S  L  R  R  S  *  H  E  I  I  R  K  I  *  L  F  N  L  V  G  N  W  M  F  M  E  K  K  F     F3
      101 GGAGAATCCATCATCGTTGAGAAGGAGCTGACACGAAATCATACGGAAGATATGATTGTTCAATTTGGTGGGCAATTGGATGTTCATGGAAAAGAAATTC 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           Y  S  R  W  S  G  I  F  S  A  R  N  H  S  S  R  *  H  F  K  C  S  I  L  V  G  C  W  V  G  C  S  R     F1
            I  Q  G  G  Q  E  F  S  A  Q  E  I  T  V  P  G  D  I  S  S  A  A  F  W  L  V  A  G  L  V  V  P  G    F2
          V  F  K  V  V  R  N  F  Q  R  K  K  S  Q  F  Q  V  T  F  Q  V  Q  H  S  G  W  L  L  G  W  L  F  Q  D   F3
      201 GTATTCAAGGTGGTCAGGAATTTTCAGCGCAAGAAATCACAGTTCCAGGTGACATTTCAAGTGCAGCATTCTGGTTGGTTGCTGGGTTGGTTGTTCCAGG 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          I  K  D  Y  T  R  K  C  W  Y  *  R  D  A  Y  R  N  F  R  C  H  *  G  H  G  R  E  T  D  L  V  E  C  *   F1
           S  K  I  T  L  E  N  V  G  I  N  E  T  R  T  G  I  L  D  V  I  K  A  M  G  G  K  L  T  L  S  N  V     F2
            Q  R  L  H  *  K  M  L  V  L  T  R  R  V  Q  E  F  *  M  S  L  R  P  W  A  G  N  *  P  C  R  M  L    F3
      301 ATCAAAGATTACACTAGAAAATGTTGGTATTAACGAGACGCGTACAGGAATTTTAGATGTCATTAAGGCCATGGGCGGGAAACTGACCTTGTCGAATGTT 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            *  T  R  *  I  C  H  H  Y  S  *  I  F  R  P  T  C  H  R  N  W  W  *  I  N  S  T  F  N  R  *  T  A    F1
          D  E  L  A  K  S  A  T  I  T  V  E  Y  S  D  L  H  A  T  E  I  G  G  E  L  I  P  R  L  I  D  E  L  P   F2
           M  N  S  L  N  L  P  P  L  Q  L  N  I  Q  T  Y  M  P  Q  K  L  V  V  N  *  F  H  V  *  *  M  N  C     F3
      401 GATGAACTCGCTAAATCTGCCACCATTACAGTTGAATATTCAGACCTACATGCCACAGAAATTGGTGGTGAATTAATTCCACGTTTAATAGATGAACTGC 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           Y  H  C  L  I  S  N  S  S  K  W  Y  N  C  D  S  G  C  *  R  T  X                                      F1
            I  I  A  L  L  A  T  Q  A  N  G  T  T  V  I  R  D  A  E  E  L  X                                     F2
          L  S  L  P  Y  *  Q  L  K  Q  M  V  Q  L  *  F  G  M  L  K  N  S                                       F3
      501 CTATCATTGCCTTATTAGCAACTCAAGCAAATGGTACAACTGTGATTCGGGATGCTGAAGAACTCA 566
          ----:----|----:----|----:----|----:----|----:----|----:----|----:-