PubMLST Database home Contents
Log in
Help

Query sequences for Salmonella locus/sequence definitions database

You can also search using the locus-specific query page. Use this page for access to the sequence analysis or export plugins.

Please enter your search criteria below (or leave blank and submit to return all records). Matching sequences will be returned and you will then be able to update their display and query settings.

Search criteria
  • +
Display
  • records per page
Action Reset

4,130 records returned (1 - 25 displayed). Click the hyperlinks for detailed information.

Page:1
locusallele idsequencesequence lengthtype allele
SEN04011832ATGGCATGTGGCGAA ... TTTGCCACGCCTTAA978
SEN04011833ATGGCATGTGGCGAG ... TTTGCCACGCCATAA978
SNSL254_A1382328ATGGTTTTTTATGAG ... CCAGGCGGGTAGTAA116
SNSL254_A1382329ATGGTTTTTTATTGG ... CTGGGCTGGTGGTAA117
SPAB_04503186ATGACGCTTACGCAG ... CGTGACAGGAAGTCA97
SPAB_04503187ATGACGCTTACGCAG ... CGTGACAGGAAGTAA108
STM08343122ATGAATTCAACCCTT ... TTTTCACTAAAATAA1581
STM08343123ATGAATTCAACCCTT ... TTTTCCCTAAAATAA1581
STM08343124ATGAATTCAACCCTT ... TTTTCACTAAAATAA1581
STM08343125ATGAATTCAACCCTT ... TTTTCACTAAAATAA1581
STM09423592ATGACGGCATTGCTT ... CTGGCAAGGGAGTAA1947
STM09423593ATGACGGCGCTGCTT ... CTGGCAAGGGAGTAG1947
STM09423594ATGACGGCATTGCTT ... CTGGCAAGGGAGTAA1947
STM09423595ATGACGGCATTGCTT ... CTGGCAAGGGAGTAA1947
STM09423596ATGACGGCATTGCTT ... CTGGCAAGGGAGTAA1947
STM09423597ATGACGGCATTGCTT ... CTGGCAAGGGAGTAA1947
STM1092230ATGCCAGCAAAGCCC ... GGGCATAAGCTATAG171
STM19403076ATGATGATGCAAAAG ... GGTTATATAGAATAG1440
STM19403077ATGATGATGCAAAAC ... GGTTATATAGAATAG1440
STM266653ATGACGCTAGCCCGGTTCCTCTTCGCATGCTTTTTTATCTTCCCCTGA48
STM2932765ATGCCCGGTATGGTC ... TGGCTACTGGGGTAG357
STM30122302ATGATGGCGACAATG ... CAACGTCCGGCCTAA1023
STM30122303ATGATGGCCACAATG ... CAACGTCCGGCCTAA1023
STM30122304ATGATGGCGACAATG ... CAACGTCCGGCCTAA1023
STM30122305ATGATGGCGACAATG ... CAACGTCCGGTCTAA1023
Page:1