tly allele sequence: id-228

Contig position

sequence bin id
2673
contig length
3004832
start
2029413
end
2030189
length
777
orientation
reverse
complete
yes
method
Illumina
Options

Sequence

CGTCGTCCCG CGTGGCATGG GTGACGACGA CAACGTATCT CGAAGGGCTC GTGTCGTTCA CAAGACCACA GTAGCGGCCC ATGATCTGCC CGGACGTCTG TCACCGACCC GTACGTTCCA GCAAGAAGAA GTGCTCAACG TTTCCATCCT GCCCGGGCAA CGGGCTATCG CACTCGTCAC GCATACGCCA ACCCAGATCT ACCGCTGCTG CCATGACACC CGCGATGGCC TGCAAGCGCA GGGCCGGGTC CGTGACAACG CCATGGGCTC CCAAAGCCTT GCGACCAACC TCAAATTGAG GCTTCACCAG CAGCAGCATG AGGCCGTCTG GGCTGACAAC AGCTGACATG GGTTCAAGGA TCATCGTCAA GGAGATAAAA GAGACATCTC CGACCACGAG GTCCACCGGC TCAACAACGC CGTCAACCGC CAGGTCTGCA GGCTGAAGAT CACGCAAGTT CAAGCCTTCA TGAACAATGA CACGGGGATC ATTCCGCAGC ACCGGAGACA TCTGGTCATG ACCAACATCG ACGGCATGCA CAAGTTTGGC TCCCCGTGAC AGCACAACTT GGGTGAACCC GCCGGTGGAC GCACCAGCAT CAAGCACTCT TGACGGCACT TGGACGCCAA GGATATCCAA GGCACCTAGA AGTTTGTGTG CTCCGCGAGA CACCCACACC TCTTCGTCGG CGACCAGCAC GTCGGCGGTA CTCACTTTCA TCGCCGGTTT AGTAACGACG ACTCTATTGA CCGTCACTCT GCCTTCCCGC ACTAGGCGTG TGGCAAGAGT GCGGGAACGT GCCAGTCCGG CTTCAACAAG GGCCTGGTCA AGTCTCACAG GGACAGACTG CCACCTCCGA GACCTTGGTG CATCCATCGG CGGCAGCCTC ATCCGTCGGC GTAGCAGGTC TTCTGCCACG CAGTGTCCAC AGCGTTAATC GTCGCATTGC ACTCACGTCC TGCCTGCATC TGGTGTT

Translation

Internal stop codons at positions: 344, 557, 611, 647, 773 (numbering includes upstream flanking sequence).

          R  R  P  A  W  H  G  *  R  R  Q  R  I  S  K  G  S  C  R  S  Q  D  H  S  S  G  P  *  S  A  R  T  S  V   F1
           V  V  P  R  G  M  G  D  D  D  N  V  S  R  R  A  R  V  V  H  K  T  T  V  A  A  H  D  L  P  G  R  L     F2
            S  S  R  V  A  W  V  T  T  T  T  Y  L  E  G  L  V  S  F  T  R  P  Q  *  R  P  M  I  C  P  D  V  C    F3
        1 CGTCGTCCCGCGTGGCATGGGTGACGACGACAACGTATCTCGAAGGGCTCGTGTCGTTCACAAGACCACAGTAGCGGCCCATGATCTGCCCGGACGTCTG 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            T  D  P  Y  V  P  A  R  R  S  A  Q  R  F  H  P  A  R  A  T  G  Y  R  T  R  H  A  Y  A  N  P  D  L    F1
          S  P  T  R  T  F  Q  Q  E  E  V  L  N  V  S  I  L  P  G  Q  R  A  I  A  L  V  T  H  T  P  T  Q  I  Y   F2
           H  R  P  V  R  S  S  K  K  K  C  S  T  F  P  S  C  P  G  N  G  L  S  H  S  S  R  I  R  Q  P  R  S     F3
      101 TCACCGACCCGTACGTTCCAGCAAGAAGAAGTGCTCAACGTTTCCATCCTGCCCGGGCAACGGGCTATCGCACTCGTCACGCATACGCCAACCCAGATCT 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           P  L  L  P  *  H  P  R  W  P  A  S  A  G  P  G  P  *  Q  R  H  G  L  P  K  P  C  D  Q  P  Q  I  E     F1
            R  C  C  H  D  T  R  D  G  L  Q  A  Q  G  R  V  R  D  N  A  M  G  S  Q  S  L  A  T  N  L  K  L  R    F2
          T  A  A  A  M  T  P  A  M  A  C  K  R  R  A  G  S  V  T  T  P  W  A  P  K  A  L  R  P  T  S  N  *  G   F3
      201 ACCGCTGCTGCCATGACACCCGCGATGGCCTGCAAGCGCAGGGCCGGGTCCGTGACAACGCCATGGGCTCCCAAAGCCTTGCGACCAACCTCAAATTGAG 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          A  S  P  A  A  A  *  G  R  L  G  *  Q  Q  L  T  W  V  Q  G  S  S  S  R  R  *  K  R  H  L  R  P  R  G   F1
           L  H  Q  Q  Q  H  E  A  V  W  A  D  N  S  *  H  G  F  K  D  H  R  Q  G  D  K  R  D  I  S  D  H  E     F2
            F  T  S  S  S  M  R  P  S  G  L  T  T  A  D  M  G  S  R  I  I  V  K  E  I  K  E  T  S  P  T  T  R    F3
      301 GCTTCACCAGCAGCAGCATGAGGCCGTCTGGGCTGACAACAGCTGACATGGGTTCAAGGATCATCGTCAAGGAGATAAAAGAGACATCTCCGACCACGAG 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            P  P  A  Q  Q  R  R  Q  P  P  G  L  Q  A  E  D  H  A  S  S  S  L  H  E  Q  *  H  G  D  H  S  A  A    F1
          V  H  R  L  N  N  A  V  N  R  Q  V  C  R  L  K  I  T  Q  V  Q  A  F  M  N  N  D  T  G  I  I  P  Q  H   F2
           S  T  G  S  T  T  P  S  T  A  R  S  A  G  *  R  S  R  K  F  K  P  S  *  T  M  T  R  G  S  F  R  S     F3
      401 GTCCACCGGCTCAACAACGCCGTCAACCGCCAGGTCTGCAGGCTGAAGATCACGCAAGTTCAAGCCTTCATGAACAATGACACGGGGATCATTCCGCAGC 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           P  E  T  S  G  H  D  Q  H  R  R  H  A  Q  V  W  L  P  V  T  A  Q  L  G  *  T  R  R  W  T  H  Q  H     F1
            R  R  H  L  V  M  T  N  I  D  G  M  H  K  F  G  S  P  *  Q  H  N  L  G  E  P  A  G  G  R  T  S  I    F2
          T  G  D  I  W  S  *  P  T  S  T  A  C  T  S  L  A  P  R  D  S  T  T  W  V  N  P  P  V  D  A  P  A  S   F3
      501 ACCGGAGACATCTGGTCATGACCAACATCGACGGCATGCACAAGTTTGGCTCCCCGTGACAGCACAACTTGGGTGAACCCGCCGGTGGACGCACCAGCAT 600
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          Q  A  L  L  T  A  L  G  R  Q  G  Y  P  R  H  L  E  V  C  V  L  R  E  T  P  T  P  L  R  R  R  P  A  R   F1
           K  H  S  *  R  H  L  D  A  K  D  I  Q  G  T  *  K  F  V  C  S  A  R  H  P  H  L  F  V  G  D  Q  H     F2
            S  T  L  D  G  T  W  T  P  R  I  S  K  A  P  R  S  L  C  A  P  R  D  T  H  T  S  S  S  A  T  S  T    F3
      601 CAAGCACTCTTGACGGCACTTGGACGCCAAGGATATCCAAGGCACCTAGAAGTTTGTGTGCTCCGCGAGACACCCACACCTCTTCGTCGGCGACCAGCAC 700
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            R  R  Y  S  L  S  S  P  V  *  *  R  R  L  Y  *  P  S  L  C  L  P  A  L  G  V  W  Q  E  C  G  N  V    F1
          V  G  G  T  H  F  H  R  R  F  S  N  D  D  S  I  D  R  H  S  A  F  P  H  *  A  C  G  K  S  A  G  T  C   F2
           S  A  V  L  T  F  I  A  G  L  V  T  T  T  L  L  T  V  T  L  P  S  R  T  R  R  V  A  R  V  R  E  R     F3
      701 GTCGGCGGTACTCACTTTCATCGCCGGTTTAGTAACGACGACTCTATTGACCGTCACTCTGCCTTCCCGCACTAGGCGTGTGGCAAGAGTGCGGGAACGT 800
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           P  V  R  L  Q  Q  G  P  G  Q  V  S  Q  G  Q  T  A  T  S  E  T  L  V  H  P  S  A  A  A  S  S  V  G     F1
            Q  S  G  F  N  K  G  L  V  K  S  H  R  D  R  L  P  P  P  R  P  W  C  I  H  R  R  Q  P  H  P  S  A    F2
          A  S  P  A  S  T  R  A  W  S  S  L  T  G  T  D  C  H  L  R  D  L  G  A  S  I  G  G  S  L  I  R  R  R   F3
      801 GCCAGTCCGGCTTCAACAAGGGCCTGGTCAAGTCTCACAGGGACAGACTGCCACCTCCGAGACCTTGGTGCATCCATCGGCGGCAGCCTCATCCGTCGGC 900
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          V  A  G  L  L  P  R  S  V  H  S  V  N  R  R  I  A  L  T  S  C  L  H  L  V  X                           F1
           *  Q  V  F  C  H  A  V  S  T  A  L  I  V  A  L  H  S  R  P  A  C  I  W  C  X                          F2
            S  R  S  S  A  T  Q  C  P  Q  R  *  S  S  H  C  T  H  V  L  P  A  S  G  V                            F3
      901 GTAGCAGGTCTTCTGCCACGCAGTGTCCACAGCGTTAATCGTCGCATTGCACTCACGTCCTGCCTGCATCTGGTGTT 977
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:--