recA allele sequence: id-228

Contig position

sequence bin id
2673
contig length
3004832
start
2478384
end
2479430
length
1047
orientation
reverse
complete
yes
method
Illumina
Options

Sequence

AGGGAGCTCG GTGGGGTTCT CTCATCGCCA CATATGATCA ACGTCGCGGC GGTGCCGCGC GTCAAATGGG GCGGGAGACC GCCTTCGAGG AAGGAACGAC ATGGCAGCGA CCGCTGACCG CGAAAAGGCC CTTGCCACGG CCTTGCAGCA GATCGAGAAG CAGCACGGCA AGGGCTCTAT CATGCGCCTT GGCGAGCAGG AGACCGTTAA GATCGCCGCT ATCCCCACGG GCTCGGTGGC CCTCGACGTC GCGTTGGGTG TCGGAGGCCT CCCACGTGGC AGAATCGTGG AGATCTATGG TCCCGAATCC TCCGGCAAGA CGACGGTGGC TTTGCACGCA ATCGCTAATG CCCAGGCTGA AGGCGGCATC TGTGCCTTTA TTGACGCCGA GCACGCTCTC GACCCGGAAT ACGCACGCAA ACTCGGGGTC GATACAGATT CCCTGCTGGT GAGCCAGCCT GACAATGGTG AGCAGGCTCT CGAGATTGCT GACACCCTCG TCCGCTCGGG TGCCTTGGAG CTCATCGTTG TTGACTCGGT GGCCGCTCTG ACCCCGAAGG CTGAGATCGA GGGCGAGATG GGTGATTCCC ATGTTGGTTT GCAGGCCCGC CTTATGAGCC AGGCCCTGCG CAAGATGACC GGTGCGTTGA ATGCGGCCGG TACCACTGCC ATCTTCATTA ATCAGCTGCG CGAGAAGATC GGTGTCATGT TTGGCTCCCC GGAGACAACG ACAGGTGGTC GCGCCCTCAA GTTCTACTCG TCCGTGCGCC TCGACGTGCG GCGTGTCGAA ACTCTTAAAG ACGGATCAGA GATGGTCGGT AACCGCACTC GTGTCAAGGT TGCCAAGAAC AAGGTCGCCC CACCTTTTAA GCAGGCAGAG TTTGACATCC TTTACGGACA GGGCATTTCT CGCGAGGGAA GCCTCATCGA CATGGGCGTA GATTGCGGCA TCATCACCAA ATCCGGTTCG TGGTTCAGCT ACAACAATGA GCAGTTGGGT CAGGGTAAGG AGAACGTCCG AAAGTTCCTC AGAGGTAACC CGGATGTTGC CAATGAGATT GAGGACAAGA TCCTGACTCA CCTTGGCCTG CGCGAAGCCG AGGTCCCTGA AGGTGTCGAT CCCCGAACTG GCGAGGTGGA ATTCTGAGTC GCCGACGCCA GGATCTGCAG CCAGAATTGA CTGATGACCA GTGGTATGAG GAAGCTCGGG AGATCTGCCT CAAGCGACTG GATCGTCGGG CTAATAC

Translation


          R  E  L  G  G  V  L  S  S  P  H  M  I  N  V  A  A  V  P  R  V  K  W  G  G  R  P  P  S  R  K  E  R  H   F1
           G  S  S  V  G  F  S  H  R  H  I  *  S  T  S  R  R  C  R  A  S  N  G  A  G  D  R  L  R  G  R  N  D     F2
            G  A  R  W  G  S  L  I  A  T  Y  D  Q  R  R  G  G  A  A  R  Q  M  G  R  E  T  A  F  E  E  G  T  T    F3
        1 AGGGAGCTCGGTGGGGTTCTCTCATCGCCACATATGATCAACGTCGCGGCGGTGCCGCGCGTCAAATGGGGCGGGAGACCGCCTTCGAGGAAGGAACGAC 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            G  S  D  R  *  P  R  K  G  P  C  H  G  L  A  A  D  R  E  A  A  R  Q  G  L  Y  H  A  P  W  R  A  G    F1
          M  A  A  T  A  D  R  E  K  A  L  A  T  A  L  Q  Q  I  E  K  Q  H  G  K  G  S  I  M  R  L  G  E  Q  E   F2
           W  Q  R  P  L  T  A  K  R  P  L  P  R  P  C  S  R  S  R  S  S  T  A  R  A  L  S  C  A  L  A  S  R     F3
      101 ATGGCAGCGACCGCTGACCGCGAAAAGGCCCTTGCCACGGCCTTGCAGCAGATCGAGAAGCAGCACGGCAAGGGCTCTATCATGCGCCTTGGCGAGCAGG 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           D  R  *  D  R  R  Y  P  H  G  L  G  G  P  R  R  R  V  G  C  R  R  P  P  T  W  Q  N  R  G  D  L  W     F1
            T  V  K  I  A  A  I  P  T  G  S  V  A  L  D  V  A  L  G  V  G  G  L  P  R  G  R  I  V  E  I  Y  G    F2
          R  P  L  R  S  P  L  S  P  R  A  R  W  P  S  T  S  R  W  V  S  E  A  S  H  V  A  E  S  W  R  S  M  V   F3
      201 AGACCGTTAAGATCGCCGCTATCCCCACGGGCTCGGTGGCCCTCGACGTCGCGTTGGGTGTCGGAGGCCTCCCACGTGGCAGAATCGTGGAGATCTATGG 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          S  R  I  L  R  Q  D  D  G  G  F  A  R  N  R  *  C  P  G  *  R  R  H  L  C  L  Y  *  R  R  A  R  S  R   F1
           P  E  S  S  G  K  T  T  V  A  L  H  A  I  A  N  A  Q  A  E  G  G  I  C  A  F  I  D  A  E  H  A  L     F2
            P  N  P  P  A  R  R  R  W  L  C  T  Q  S  L  M  P  R  L  K  A  A  S  V  P  L  L  T  P  S  T  L  S    F3
      301 TCCCGAATCCTCCGGCAAGACGACGGTGGCTTTGCACGCAATCGCTAATGCCCAGGCTGAAGGCGGCATCTGTGCCTTTATTGACGCCGAGCACGCTCTC 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            P  G  I  R  T  Q  T  R  G  R  Y  R  F  P  A  G  E  P  A  *  Q  W  *  A  G  S  R  D  C  *  H  P  R    F1
          D  P  E  Y  A  R  K  L  G  V  D  T  D  S  L  L  V  S  Q  P  D  N  G  E  Q  A  L  E  I  A  D  T  L  V   F2
           T  R  N  T  H  A  N  S  G  S  I  Q  I  P  C  W  *  A  S  L  T  M  V  S  R  L  S  R  L  L  T  P  S     F3
      401 GACCCGGAATACGCACGCAAACTCGGGGTCGATACAGATTCCCTGCTGGTGAGCCAGCCTGACAATGGTGAGCAGGCTCTCGAGATTGCTGACACCCTCG 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           P  L  G  C  L  G  A  H  R  C  *  L  G  G  R  S  D  P  E  G  *  D  R  G  R  D  G  *  F  P  C  W  F     F1
            R  S  G  A  L  E  L  I  V  V  D  S  V  A  A  L  T  P  K  A  E  I  E  G  E  M  G  D  S  H  V  G  L    F2
          S  A  R  V  P  W  S  S  S  L  L  T  R  W  P  L  *  P  R  R  L  R  S  R  A  R  W  V  I  P  M  L  V  C   F3
      501 TCCGCTCGGGTGCCTTGGAGCTCATCGTTGTTGACTCGGTGGCCGCTCTGACCCCGAAGGCTGAGATCGAGGGCGAGATGGGTGATTCCCATGTTGGTTT 600
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          A  G  P  P  Y  E  P  G  P  A  Q  D  D  R  C  V  E  C  G  R  Y  H  C  H  L  H  *  S  A  A  R  E  D  R   F1
           Q  A  R  L  M  S  Q  A  L  R  K  M  T  G  A  L  N  A  A  G  T  T  A  I  F  I  N  Q  L  R  E  K  I     F2
            R  P  A  L  *  A  R  P  C  A  R  *  P  V  R  *  M  R  P  V  P  L  P  S  S  L  I  S  C  A  R  R  S    F3
      601 GCAGGCCCGCCTTATGAGCCAGGCCCTGCGCAAGATGACCGGTGCGTTGAATGCGGCCGGTACCACTGCCATCTTCATTAATCAGCTGCGCGAGAAGATC 700
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            C  H  V  W  L  P  G  D  N  D  R  W  S  R  P  Q  V  L  L  V  R  A  P  R  R  A  A  C  R  N  S  *  R    F1
          G  V  M  F  G  S  P  E  T  T  T  G  G  R  A  L  K  F  Y  S  S  V  R  L  D  V  R  R  V  E  T  L  K  D   F2
           V  S  C  L  A  P  R  R  Q  R  Q  V  V  A  P  S  S  S  T  R  P  C  A  S  T  C  G  V  S  K  L  L  K     F3
      701 GGTGTCATGTTTGGCTCCCCGGAGACAACGACAGGTGGTCGCGCCCTCAAGTTCTACTCGTCCGTGCGCCTCGACGTGCGGCGTGTCGAAACTCTTAAAG 800
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           R  I  R  D  G  R  *  P  H  S  C  Q  G  C  Q  E  Q  G  R  P  T  F  *  A  G  R  V  *  H  P  L  R  T     F1
            G  S  E  M  V  G  N  R  T  R  V  K  V  A  K  N  K  V  A  P  P  F  K  Q  A  E  F  D  I  L  Y  G  Q    F2
          T  D  Q  R  W  S  V  T  A  L  V  S  R  L  P  R  T  R  S  P  H  L  L  S  R  Q  S  L  T  S  F  T  D  R   F3
      801 ACGGATCAGAGATGGTCGGTAACCGCACTCGTGTCAAGGTTGCCAAGAACAAGGTCGCCCCACCTTTTAAGCAGGCAGAGTTTGACATCCTTTACGGACA 900
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          G  H  F  S  R  G  K  P  H  R  H  G  R  R  L  R  H  H  H  Q  I  R  F  V  V  Q  L  Q  Q  *  A  V  G  S   F1
           G  I  S  R  E  G  S  L  I  D  M  G  V  D  C  G  I  I  T  K  S  G  S  W  F  S  Y  N  N  E  Q  L  G     F2
            A  F  L  A  R  E  A  S  S  T  W  A  *  I  A  A  S  S  P  N  P  V  R  G  S  A  T  T  M  S  S  W  V    F3
      901 GGGCATTTCTCGCGAGGGAAGCCTCATCGACATGGGCGTAGATTGCGGCATCATCACCAAATCCGGTTCGTGGTTCAGCTACAACAATGAGCAGTTGGGT 1000
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            G  *  G  E  R  P  K  V  P  Q  R  *  P  G  C  C  Q  *  D  *  G  Q  D  P  D  S  P  W  P  A  R  S  R    F1
          Q  G  K  E  N  V  R  K  F  L  R  G  N  P  D  V  A  N  E  I  E  D  K  I  L  T  H  L  G  L  R  E  A  E   F2
           R  V  R  R  T  S  E  S  S  S  E  V  T  R  M  L  P  M  R  L  R  T  R  S  *  L  T  L  A  C  A  K  P     F3
     1001 CAGGGTAAGGAGAACGTCCGAAAGTTCCTCAGAGGTAACCCGGATGTTGCCAATGAGATTGAGGACAAGATCCTGACTCACCTTGGCCTGCGCGAAGCCG 1100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           G  P  *  R  C  R  S  P  N  W  R  G  G  I  L  S  R  R  R  Q  D  L  Q  P  E  L  T  D  D  Q  W  Y  E     F1
            V  P  E  G  V  D  P  R  T  G  E  V  E  F  *  V  A  D  A  R  I  C  S  Q  N  *  L  M  T  S  G  M  R    F2
          R  S  L  K  V  S  I  P  E  L  A  R  W  N  S  E  S  P  T  P  G  S  A  A  R  I  D  *  *  P  V  V  *  G   F3
     1101 AGGTCCCTGAAGGTGTCGATCCCCGAACTGGCGAGGTGGAATTCTGAGTCGCCGACGCCAGGATCTGCAGCCAGAATTGACTGATGACCAGTGGTATGAG 1200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          E  A  R  E  I  C  L  K  R  L  D  R  R  A  N  T                                                         F1
           K  L  G  R  S  A  S  S  D  W  I  V  G  L  I  X                                                        F2
            S  S  G  D  L  P  Q  A  T  G  S  S  G  *  Y                                                          F3
     1201 GAAGCTCGGGAGATCTGCCTCAAGCGACTGGATCGTCGGGCTAATAC 1247
          ----:----|----:----|----:----|----:----|----:--