rpoB allele sequence: id-84

Contig position

sequence bin id
113
contig length
65815
start
21011
end
21505
length
495
orientation
forward
complete
yes
method
Illumina
Options

Sequence

TATTTCTTAC ATATTTGCGG AAGAAATGCT TGTTACACAT ATATTACGCA TGATTTGAGG GGTGAATCAG TTGACAGGTC AACTAGTTCA GTATGGACGA CACCGCCAGC GCAGAAGCTA TGCACGCATT AGCGAAGTGT TAGAATTACC AAATCTCATT GAAATTCAAA CCTCTTCTTA TCAGTGGTTT CTTGATGAGG GTCTTAGAGA GATGTTTCAA GACATATCGC CAATTGAGGA TTTCACTGGT AACCTCTCTC TGGAATTTAT CGACTACAGC TTGGGCGAGC CTAAGTATCC GGTAGAAGAA TCAAAAGAGC GCGACGTGAC CTACTCAGCT CCGCTGCGTG TTAAAGTCCG CTTAATCAAC AAAGAGACCG GTGAAGTAAA GGATCAGGAT GTCTTCATGG GTGATTTCCC TATTATGACA GACACTGGAA CCTTTATTAT CAACGGTGCG GAACGGGTCA TTGTATCTCA GCTCGTTCGT TCTCCAAGTG TATATTTTAG TGGTAAAGTA GACAAAAACG GTAAGAAAGG TTTTACCGCG ACTGTCATTC CAAACCGTGG CGCATGGTTA GAATACGAGA CTGATGCGAA AGATGTTGTT TATGTACGCA TCGATCGCAC ACGTAAGTTG CCGGTTACGG TTCTTTTGCG TGCTCTTGGC TTCGGATCTG ACCAAGAGAT CATTG

Translation


          Y  F  L  H  I  C  G  R  N  A  C  Y  T  Y  I  T  H  D  L  R  G  E  S  V  D  R  S  T  S  S  V  W  T  T   F1
           I  S  Y  I  F  A  E  E  M  L  V  T  H  I  L  R  M  I  *  G  V  N  Q  L  T  G  Q  L  V  Q  Y  G  R     F2
            F  L  T  Y  L  R  K  K  C  L  L  H  I  Y  Y  A  *  F  E  G  *  I  S  *  Q  V  N  *  F  S  M  D  D    F3
        1 TATTTCTTACATATTTGCGGAAGAAATGCTTGTTACACATATATTACGCATGATTTGAGGGGTGAATCAGTTGACAGGTCAACTAGTTCAGTATGGACGA 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            P  P  A  Q  K  L  C  T  H  *  R  S  V  R  I  T  K  S  H  *  N  S  N  L  F  L  S  V  V  S  *  *  G    F1
          H  R  Q  R  R  S  Y  A  R  I  S  E  V  L  E  L  P  N  L  I  E  I  Q  T  S  S  Y  Q  W  F  L  D  E  G   F2
           T  A  S  A  E  A  M  H  A  L  A  K  C  *  N  Y  Q  I  S  L  K  F  K  P  L  L  I  S  G  F  L  M  R     F3
      101 CACCGCCAGCGCAGAAGCTATGCACGCATTAGCGAAGTGTTAGAATTACCAAATCTCATTGAAATTCAAACCTCTTCTTATCAGTGGTTTCTTGATGAGG 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           S  *  R  D  V  S  R  H  I  A  N  *  G  F  H  W  *  P  L  S  G  I  Y  R  L  Q  L  G  R  A  *  V  S     F1
            L  R  E  M  F  Q  D  I  S  P  I  E  D  F  T  G  N  L  S  L  E  F  I  D  Y  S  L  G  E  P  K  Y  P    F2
          V  L  E  R  C  F  K  T  Y  R  Q  L  R  I  S  L  V  T  S  L  W  N  L  S  T  T  A  W  A  S  L  S  I  R   F3
      201 GTCTTAGAGAGATGTTTCAAGACATATCGCCAATTGAGGATTTCACTGGTAACCTCTCTCTGGAATTTATCGACTACAGCTTGGGCGAGCCTAAGTATCC 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          G  R  R  I  K  R  A  R  R  D  L  L  S  S  A  A  C  *  S  P  L  N  Q  Q  R  D  R  *  S  K  G  S  G  C   F1
           V  E  E  S  K  E  R  D  V  T  Y  S  A  P  L  R  V  K  V  R  L  I  N  K  E  T  G  E  V  K  D  Q  D     F2
            *  K  N  Q  K  S  A  T  *  P  T  Q  L  R  C  V  L  K  S  A  *  S  T  K  R  P  V  K  *  R  I  R  M    F3
      301 GGTAGAAGAATCAAAAGAGCGCGACGTGACCTACTCAGCTCCGCTGCGTGTTAAAGTCCGCTTAATCAACAAAGAGACCGGTGAAGTAAAGGATCAGGAT 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            L  H  G  *  F  P  Y  Y  D  R  H  W  N  L  Y  Y  Q  R  C  G  T  G  H  C  I  S  A  R  S  F  S  K  C    F1
          V  F  M  G  D  F  P  I  M  T  D  T  G  T  F  I  I  N  G  A  E  R  V  I  V  S  Q  L  V  R  S  P  S  V   F2
           S  S  W  V  I  S  L  L  *  Q  T  L  E  P  L  L  S  T  V  R  N  G  S  L  Y  L  S  S  F  V  L  Q  V     F3
      401 GTCTTCATGGGTGATTTCCCTATTATGACAGACACTGGAACCTTTATTATCAACGGTGCGGAACGGGTCATTGTATCTCAGCTCGTTCGTTCTCCAAGTG 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           I  F  *  W  *  S  R  Q  K  R  *  E  R  F  Y  R  D  C  H  S  K  P  W  R  M  V  R  I  R  D  *  C  E     F1
            Y  F  S  G  K  V  D  K  N  G  K  K  G  F  T  A  T  V  I  P  N  R  G  A  W  L  E  Y  E  T  D  A  K    F2
          Y  I  L  V  V  K  *  T  K  T  V  R  K  V  L  P  R  L  S  F  Q  T  V  A  H  G  *  N  T  R  L  M  R  K   F3
      501 TATATTTTAGTGGTAAAGTAGACAAAAACGGTAAGAAAGGTTTTACCGCGACTGTCATTCCAAACCGTGGCGCATGGTTAGAATACGAGACTGATGCGAA 600
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          R  C  C  L  C  T  H  R  S  H  T  *  V  A  G  Y  G  S  F  A  C  S  W  L  R  I  *  P  R  D  H  X         F1
           D  V  V  Y  V  R  I  D  R  T  R  K  L  P  V  T  V  L  L  R  A  L  G  F  G  S  D  Q  E  I  I  X        F2
            M  L  F  M  Y  A  S  I  A  H  V  S  C  R  L  R  F  F  C  V  L  L  A  S  D  L  T  K  R  S  L          F3
      601 AGATGTTGTTTATGTACGCATCGATCGCACACGTAAGTTGCCGGTTACGGTTCTTTTGCGTGCTCTTGGCTTCGGATCTGACCAAGAGATCATTG 695
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----: