spo0A allele sequence: id-61

Contig position

sequence bin id
4
contig length
4389210
start
2363268
end
2363825
length
558
orientation
reverse
complete
yes
method
Illumina
Options

Sequence

TGATGATAAC AGGGAGCTTG TCGGCCTATT AAGCGAATAT ATCGAGGGAC AAAGCGACAT GGAAGTACTT GGTGTCGCGT ACAACGGACA GGAATGCCTT TCGTTGTTTA AAGACAAGGA GCCCGATGTG CTTGTGCTGG ATATTATCAT GCCTCACCTC GATGGATTGG CCGTTCTTGA AAGGCTGAGG GAATCGCAGC TTAAAAAGCA GCCGAATGTC ATCATGCTGA CGGCGTTCGG TCAGGAAGAC GTGACGAAAA AAGCTGTAGA TTTGGGCGCG TCGTATTTTA TTTTGAAGCC TTTTGACATG GAGAACTTAG TCGGCCATAT CCGCCAGGTC AGCGGAAACG GATCTCAATT GACACACCGT GCCCCGTCTT CTCAAAGCAG TGTGCTTCGG CCGCAGCCGG AATCGCCGAA GAAAAACCTG GACGCCAGCA TCACGACCAT CATCCACGAA ATCGGCGTGC CCGCTCATAT AAAAGGCTAT TTATACTTAA GGGAAGCCAT CTCCATGGTG TATAACGACA TCGAACTGCT CGGAAGCATT ACAAAAGTGC TTTATCCGGA TATCGCCAAA AAATTCAACA CGACTGCAAG CCGAGTCGAA CGGGCGATTC GCCACGCCAT CGAAGTCGCA TGGAGCAGAG GCAACATCGA CTCGATTTCG TCACTTTTCG GCTACACAGT CAGCATGTCA AAAGCCAAGC CGACGAATTC AGAATTCATC GCGATGGTCG CAGACAAGCT GAGACTGG

Translation


          *  *  *  Q  G  A  C  R  P  I  K  R  I  Y  R  G  T  K  R  H  G  S  T  W  C  R  V  Q  R  T  G  M  P  F   F1
           D  D  N  R  E  L  V  G  L  L  S  E  Y  I  E  G  Q  S  D  M  E  V  L  G  V  A  Y  N  G  Q  E  C  L     F2
            M  I  T  G  S  L  S  A  Y  *  A  N  I  S  R  D  K  A  T  W  K  Y  L  V  S  R  T  T  D  R  N  A  F    F3
        1 TGATGATAACAGGGAGCTTGTCGGCCTATTAAGCGAATATATCGAGGGACAAAGCGACATGGAAGTACTTGGTGTCGCGTACAACGGACAGGAATGCCTT 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            V  V  *  R  Q  G  A  R  C  A  C  A  G  Y  Y  H  A  S  P  R  W  I  G  R  S  *  K  A  E  G  I  A  A    F1
          S  L  F  K  D  K  E  P  D  V  L  V  L  D  I  I  M  P  H  L  D  G  L  A  V  L  E  R  L  R  E  S  Q  L   F2
           R  C  L  K  T  R  S  P  M  C  L  C  W  I  L  S  C  L  T  S  M  D  W  P  F  L  K  G  *  G  N  R  S     F3
      101 TCGTTGTTTAAAGACAAGGAGCCCGATGTGCTTGTGCTGGATATTATCATGCCTCACCTCGATGGATTGGCCGTTCTTGAAAGGCTGAGGGAATCGCAGC 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           *  K  A  A  E  C  H  H  A  D  G  V  R  S  G  R  R  D  E  K  S  C  R  F  G  R  V  V  F  Y  F  E  A     F1
            K  K  Q  P  N  V  I  M  L  T  A  F  G  Q  E  D  V  T  K  K  A  V  D  L  G  A  S  Y  F  I  L  K  P    F2
          L  K  S  S  R  M  S  S  C  *  R  R  S  V  R  K  T  *  R  K  K  L  *  I  W  A  R  R  I  L  F  *  S  L   F3
      201 TTAAAAAGCAGCCGAATGTCATCATGCTGACGGCGTTCGGTCAGGAAGACGTGACGAAAAAAGCTGTAGATTTGGGCGCGTCGTATTTTATTTTGAAGCC 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          F  *  H  G  E  L  S  R  P  Y  P  P  G  Q  R  K  R  I  S  I  D  T  P  C  P  V  F  S  K  Q  C  A  S  A   F1
           F  D  M  E  N  L  V  G  H  I  R  Q  V  S  G  N  G  S  Q  L  T  H  R  A  P  S  S  Q  S  S  V  L  R     F2
            L  T  W  R  T  *  S  A  I  S  A  R  S  A  E  T  D  L  N  *  H  T  V  P  R  L  L  K  A  V  C  F  G    F3
      301 TTTTGACATGGAGAACTTAGTCGGCCATATCCGCCAGGTCAGCGGAAACGGATCTCAATTGACACACCGTGCCCCGTCTTCTCAAAGCAGTGTGCTTCGG 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            A  A  G  I  A  E  E  K  P  G  R  Q  H  H  D  H  H  P  R  N  R  R  A  R  S  Y  K  R  L  F  I  L  K    F1
          P  Q  P  E  S  P  K  K  N  L  D  A  S  I  T  T  I  I  H  E  I  G  V  P  A  H  I  K  G  Y  L  Y  L  R   F2
           R  S  R  N  R  R  R  K  T  W  T  P  A  S  R  P  S  S  T  K  S  A  C  P  L  I  *  K  A  I  Y  T  *     F3
      401 CCGCAGCCGGAATCGCCGAAGAAAAACCTGGACGCCAGCATCACGACCATCATCCACGAAATCGGCGTGCCCGCTCATATAAAAGGCTATTTATACTTAA 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           G  S  H  L  H  G  V  *  R  H  R  T  A  R  K  H  Y  K  S  A  L  S  G  Y  R  Q  K  I  Q  H  D  C  K     F1
            E  A  I  S  M  V  Y  N  D  I  E  L  L  G  S  I  T  K  V  L  Y  P  D  I  A  K  K  F  N  T  T  A  S    F2
          G  K  P  S  P  W  C  I  T  T  S  N  C  S  E  A  L  Q  K  C  F  I  R  I  S  P  K  N  S  T  R  L  Q  A   F3
      501 GGGAAGCCATCTCCATGGTGTATAACGACATCGAACTGCTCGGAAGCATTACAAAAGTGCTTTATCCGGATATCGCCAAAAAATTCAACACGACTGCAAG 600
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          P  S  R  T  G  D  S  P  R  H  R  S  R  M  E  Q  R  Q  H  R  L  D  F  V  T  F  R  L  H  S  Q  H  V  K   F1
           R  V  E  R  A  I  R  H  A  I  E  V  A  W  S  R  G  N  I  D  S  I  S  S  L  F  G  Y  T  V  S  M  S     F2
            E  S  N  G  R  F  A  T  P  S  K  S  H  G  A  E  A  T  S  T  R  F  R  H  F  S  A  T  Q  S  A  C  Q    F3
      601 CCGAGTCGAACGGGCGATTCGCCACGCCATCGAAGTCGCATGGAGCAGAGGCAACATCGACTCGATTTCGTCACTTTTCGGCTACACAGTCAGCATGTCA 700
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            S  Q  A  D  E  F  R  I  H  R  D  G  R  R  Q  A  E  T  G                                              F1
          K  A  K  P  T  N  S  E  F  I  A  M  V  A  D  K  L  R  L  X                                             F2
           K  P  S  R  R  I  Q  N  S  S  R  W  S  Q  T  S  *  D  W                                               F3
      701 AAAGCCAAGCCGACGAATTCAGAATTCATCGCGATGGTCGCAGACAAGCTGAGACTGG 758
          ----:----|----:----|----:----|----:----|----:----|----:---