spo0A allele sequence: id-57

Contig position

sequence bin id
3
contig length
4239205
start
2528248
end
2528805
length
558
orientation
reverse
complete
yes
Options

Sequence

TGATGATAAC AGGGAGCTTG TCGGCCTATT AAGCGAATAT ATCGAGGGAC AGAGCGACAT GGAAGTGCTT GGTGTCGCAT ACAACGGACA GGAATGCCTT TCTTTGTTTA AAGACAAGGA GCCCGACGTG CTTGTGCTGG ATATAATCAT GCCTCATCTC GACGGATTGG CCGTTCTTGA AAGGCTGAGG GAATCGCAGC TTAAAAAGCA GCCGAATGTC ATCATGCTGA CGGCGTTCGG CCAGGAAGAC GTGACCAAAA AAGCTGTAGA TTTAGGCGCG TCGTATTTTA TTTTGAAGCC TTTTGACATG GAGAATTTAG TCGGACATAT CCGCCAGGTC AGCGGAAACG GATCTCAATT GACACACCGT GCCCCGTCCT CTCAAAGCAG TGTGCTTCGG CCGCAGCCTG AATCGCCGAA GAAAAACCTG GACGCCAGCA TCACGACCAT CATCCACGAA ATCGGCGTAC CTGCTCATAT TAAAGGCTAT TTGTACTTAA GAGAAGCCAT CTCCATGGTA TATAACGACA TCGAACTGCT CGGCAGCATT ACAAAAGTGC TTTATCCGGA TATCGCCAAA AAATTCAACA CGACTGCAAG CCGCGTCGAA CGGGCGATTC GCCACGCCAT CGAAGTCGCA TGGAGCAGAG GCAACATCGA CTCGATTTCG TCACTTTTCG GCTACACAGT CAGCATGTCA AAAGCAAAGC CGACCAATAG TGAGTTCATC GCGATGGTCG CAGACAAGCT GAGACTGG

Translation


          *  *  *  Q  G  A  C  R  P  I  K  R  I  Y  R  G  T  E  R  H  G  S  A  W  C  R  I  Q  R  T  G  M  P  F   F1
           D  D  N  R  E  L  V  G  L  L  S  E  Y  I  E  G  Q  S  D  M  E  V  L  G  V  A  Y  N  G  Q  E  C  L     F2
            M  I  T  G  S  L  S  A  Y  *  A  N  I  S  R  D  R  A  T  W  K  C  L  V  S  H  T  T  D  R  N  A  F    F3
        1 TGATGATAACAGGGAGCTTGTCGGCCTATTAAGCGAATATATCGAGGGACAGAGCGACATGGAAGTGCTTGGTGTCGCATACAACGGACAGGAATGCCTT 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            F  V  *  R  Q  G  A  R  R  A  C  A  G  Y  N  H  A  S  S  R  R  I  G  R  S  *  K  A  E  G  I  A  A    F1
          S  L  F  K  D  K  E  P  D  V  L  V  L  D  I  I  M  P  H  L  D  G  L  A  V  L  E  R  L  R  E  S  Q  L   F2
           L  C  L  K  T  R  S  P  T  C  L  C  W  I  *  S  C  L  I  S  T  D  W  P  F  L  K  G  *  G  N  R  S     F3
      101 TCTTTGTTTAAAGACAAGGAGCCCGACGTGCTTGTGCTGGATATAATCATGCCTCATCTCGACGGATTGGCCGTTCTTGAAAGGCTGAGGGAATCGCAGC 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           *  K  A  A  E  C  H  H  A  D  G  V  R  P  G  R  R  D  Q  K  S  C  R  F  R  R  V  V  F  Y  F  E  A     F1
            K  K  Q  P  N  V  I  M  L  T  A  F  G  Q  E  D  V  T  K  K  A  V  D  L  G  A  S  Y  F  I  L  K  P    F2
          L  K  S  S  R  M  S  S  C  *  R  R  S  A  R  K  T  *  P  K  K  L  *  I  *  A  R  R  I  L  F  *  S  L   F3
      201 TTAAAAAGCAGCCGAATGTCATCATGCTGACGGCGTTCGGCCAGGAAGACGTGACCAAAAAAGCTGTAGATTTAGGCGCGTCGTATTTTATTTTGAAGCC 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          F  *  H  G  E  F  S  R  T  Y  P  P  G  Q  R  K  R  I  S  I  D  T  P  C  P  V  L  S  K  Q  C  A  S  A   F1
           F  D  M  E  N  L  V  G  H  I  R  Q  V  S  G  N  G  S  Q  L  T  H  R  A  P  S  S  Q  S  S  V  L  R     F2
            L  T  W  R  I  *  S  D  I  S  A  R  S  A  E  T  D  L  N  *  H  T  V  P  R  P  L  K  A  V  C  F  G    F3
      301 TTTTGACATGGAGAATTTAGTCGGACATATCCGCCAGGTCAGCGGAAACGGATCTCAATTGACACACCGTGCCCCGTCCTCTCAAAGCAGTGTGCTTCGG 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            A  A  *  I  A  E  E  K  P  G  R  Q  H  H  D  H  H  P  R  N  R  R  T  C  S  Y  *  R  L  F  V  L  K    F1
          P  Q  P  E  S  P  K  K  N  L  D  A  S  I  T  T  I  I  H  E  I  G  V  P  A  H  I  K  G  Y  L  Y  L  R   F2
           R  S  L  N  R  R  R  K  T  W  T  P  A  S  R  P  S  S  T  K  S  A  Y  L  L  I  L  K  A  I  C  T  *     F3
      401 CCGCAGCCTGAATCGCCGAAGAAAAACCTGGACGCCAGCATCACGACCATCATCCACGAAATCGGCGTACCTGCTCATATTAAAGGCTATTTGTACTTAA 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           R  S  H  L  H  G  I  *  R  H  R  T  A  R  Q  H  Y  K  S  A  L  S  G  Y  R  Q  K  I  Q  H  D  C  K     F1
            E  A  I  S  M  V  Y  N  D  I  E  L  L  G  S  I  T  K  V  L  Y  P  D  I  A  K  K  F  N  T  T  A  S    F2
          E  K  P  S  P  W  Y  I  T  T  S  N  C  S  A  A  L  Q  K  C  F  I  R  I  S  P  K  N  S  T  R  L  Q  A   F3
      501 GAGAAGCCATCTCCATGGTATATAACGACATCGAACTGCTCGGCAGCATTACAAAAGTGCTTTATCCGGATATCGCCAAAAAATTCAACACGACTGCAAG 600
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          P  R  R  T  G  D  S  P  R  H  R  S  R  M  E  Q  R  Q  H  R  L  D  F  V  T  F  R  L  H  S  Q  H  V  K   F1
           R  V  E  R  A  I  R  H  A  I  E  V  A  W  S  R  G  N  I  D  S  I  S  S  L  F  G  Y  T  V  S  M  S     F2
            A  S  N  G  R  F  A  T  P  S  K  S  H  G  A  E  A  T  S  T  R  F  R  H  F  S  A  T  Q  S  A  C  Q    F3
      601 CCGCGTCGAACGGGCGATTCGCCACGCCATCGAAGTCGCATGGAGCAGAGGCAACATCGACTCGATTTCGTCACTTTTCGGCTACACAGTCAGCATGTCA 700
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            S  K  A  D  Q  *  *  V  H  R  D  G  R  R  Q  A  E  T  G                                              F1
          K  A  K  P  T  N  S  E  F  I  A  M  V  A  D  K  L  R  L  X                                             F2
           K  Q  S  R  P  I  V  S  S  S  R  W  S  Q  T  S  *  D  W                                               F3
      701 AAAGCAAAGCCGACCAATAGTGAGTTCATCGCGATGGTCGCAGACAAGCTGAGACTGG 758
          ----:----|----:----|----:----|----:----|----:----|----:---