BACT000053 (rplX) allele sequence: id-331

Contig position

sequence bin id
3651
contig length
215670
start
6333
end
6641
length
309
orientation
forward
complete
yes
method
Illumina
Options

Sequence

GATCGGCACC CGCATTTTCG GGCCGGTGAC GCGTGAGCTG CGTAGCGAAC GATTCATGAA GATCGTCTCG CTGGCGCCGG AAGTGCTGTA AGGAGTCGCG ATGAACAAGA TTCGCAAGGG TGACGAAGTC ATCGTCATCG CAGGCAAGGA CAAGGGCAAG CGCGGTGTCG TGCTGGCAGT CGCCGCCGAC CGCGTGACGG TTGAAGGTAT CAACCTCGTC AAGAAGCACG TGAAGCCGAA CCCGATGAAG GGTACGACGG GTGGTGTGGA AGCGAAGACG ATGCCCCTCC ACATTTCGAA CGTCGCGGTT GTCGACGCGA ACGGCAAGGC GTCGCGTGTC GGCATCAAGG TCGAGGAAGG CAAGAAGGTT CGCTTCCTGA AGACGACCGG TGCCGTACTG AGCGCCTGAC GCAGCGGAGT AAAAAATGGC TCGTTTGCAA GAGTTTTACA AAGAAAAGGT TGTGCCCGGC CTGATCGAGA AGTTCGGTTA CAAGTCGGTC ATGGAAGTG

Translation


          D  R  H  P  H  F  R  A  G  D  A  *  A  A  *  R  T  I  H  E  D  R  L  A  G  A  G  S  A  V  R  S  R  D   F1
           I  G  T  R  I  F  G  P  V  T  R  E  L  R  S  E  R  F  M  K  I  V  S  L  A  P  E  V  L  *  G  V  A     F2
            S  A  P  A  F  S  G  R  *  R  V  S  C  V  A  N  D  S  *  R  S  S  R  W  R  R  K  C  C  K  E  S  R    F3
        1 GATCGGCACCCGCATTTTCGGGCCGGTGACGCGTGAGCTGCGTAGCGAACGATTCATGAAGATCGTCTCGCTGGCGCCGGAAGTGCTGTAAGGAGTCGCG 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            E  Q  D  S  Q  G  *  R  S  H  R  H  R  R  Q  G  Q  G  Q  A  R  C  R  A  G  S  R  R  R  P  R  D  G    F1
          M  N  K  I  R  K  G  D  E  V  I  V  I  A  G  K  D  K  G  K  R  G  V  V  L  A  V  A  A  D  R  V  T  V   F2
           *  T  R  F  A  R  V  T  K  S  S  S  S  Q  A  R  T  R  A  S  A  V  S  C  W  Q  S  P  P  T  A  *  R     F3
      101 ATGAACAAGATTCGCAAGGGTGACGAAGTCATCGTCATCGCAGGCAAGGACAAGGGCAAGCGCGGTGTCGTGCTGGCAGTCGCCGCCGACCGCGTGACGG 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           *  R  Y  Q  P  R  Q  E  A  R  E  A  E  P  D  E  G  Y  D  G  W  C  G  S  E  D  D  A  P  P  H  F  E     F1
            E  G  I  N  L  V  K  K  H  V  K  P  N  P  M  K  G  T  T  G  G  V  E  A  K  T  M  P  L  H  I  S  N    F2
          L  K  V  S  T  S  S  R  S  T  *  S  R  T  R  *  R  V  R  R  V  V  W  K  R  R  R  C  P  S  T  F  R  T   F3
      201 TTGAAGGTATCAACCTCGTCAAGAAGCACGTGAAGCCGAACCCGATGAAGGGTACGACGGGTGGTGTGGAAGCGAAGACGATGCCCCTCCACATTTCGAA 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          R  R  G  C  R  R  E  R  Q  G  V  A  C  R  H  Q  G  R  G  R  Q  E  G  S  L  P  E  D  D  R  C  R  T  E   F1
           V  A  V  V  D  A  N  G  K  A  S  R  V  G  I  K  V  E  E  G  K  K  V  R  F  L  K  T  T  G  A  V  L     F2
            S  R  L  S  T  R  T  A  R  R  R  V  S  A  S  R  S  R  K  A  R  R  F  A  S  *  R  R  P  V  P  Y  *    F3
      301 CGTCGCGGTTGTCGACGCGAACGGCAAGGCGTCGCGTGTCGGCATCAAGGTCGAGGAAGGCAAGAAGGTTCGCTTCCTGAAGACGACCGGTGCCGTACTG 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            R  L  T  Q  R  S  K  K  W  L  V  C  K  S  F  T  K  K  R  L  C  P  A  *  S  R  S  S  V  T  S  R  S    F1
          S  A  *  R  S  G  V  K  N  G  S  F  A  R  V  L  Q  R  K  G  C  A  R  P  D  R  E  V  R  L  Q  V  G  H   F2
           A  P  D  A  A  E  *  K  M  A  R  L  Q  E  F  Y  K  E  K  V  V  P  G  L  I  E  K  F  G  Y  K  S  V     F3
      401 AGCGCCTGACGCAGCGGAGTAAAAAATGGCTCGTTTGCAAGAGTTTTACAAAGAAAAGGTTGTGCCCGGCCTGATCGAGAAGTTCGGTTACAAGTCGGTC 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           W  K  X                                                                                               F1
            G  S  X                                                                                              F2
          M  E  V                                                                                                F3
      501 ATGGAAGTG 509
          ----:----