BACT000040 (rplK) allele sequence: id-331

Contig position

sequence bin id
3629
contig length
18216
start
1389
end
1820
length
432
orientation
forward
complete
yes
method
Illumina
Options

Sequence

TTACGGCCCG CGTCATGGTC GTTGAGGAGC GTCAGTAGCC AGCGGCGAAC GCGCGTTATC ACTCACCGAA CGCCGCTTGG CGTTCCAACG AGGTTTTCAA ATGGCAAAGA AGATTGTCGG CTTTATCAAG CTGCAGATTC CTGCAGGTAA AGCCAACCCG TCGCCGCCGG TCGGTCCGGC ACTGGGCCAG CGCGGCCTGA ACATCATGGA GTTCTGCAAG GCGTTCAACG CGCAGACTCA AGGTATGGAG CCGGGTCTGC CGGTGCCGGT CGTCATCACG GCATACGCTG ACAAGAGCTT CACGTTCGTG ATGAAGACGC CGCCGGCGAC CGTCCTGATC AAGAAGGCGG CGAAGGTGGA CAAGGGCTCG AGCAAGCCGC ACACCGACAA GGTCGGTTCG ATCACGCGCG CTCAAGCCGA AGAAATCGCA AAGACCAAGA TGCCGGACCT CACGGCAGCT GATCTGGACG CAGCCGTTCG CACCATCGCT GGTAGCGCAC GCTCGATGGG CATCACTGTG GAGGGCGTGT AAATGGCTAA GATCTCCAAG CGCCGTCAGG CATTTGCCGC CAAGGTCGAC CGTCAGAAGC TGTACGCGAT CGACGACGCA CTGGCACTCG TGAAGGAATG CG

Translation


          L  R  P  A  S  W  S  L  R  S  V  S  S  Q  R  R  T  R  V  I  T  H  R  T  P  L  G  V  P  T  R  F  S  N   F1
           Y  G  P  R  H  G  R  *  G  A  S  V  A  S  G  E  R  A  L  S  L  T  E  R  R  L  A  F  Q  R  G  F  Q     F2
            T  A  R  V  M  V  V  E  E  R  Q  *  P  A  A  N  A  R  Y  H  S  P  N  A  A  W  R  S  N  E  V  F  K    F3
        1 TTACGGCCCGCGTCATGGTCGTTGAGGAGCGTCAGTAGCCAGCGGCGAACGCGCGTTATCACTCACCGAACGCCGCTTGGCGTTCCAACGAGGTTTTCAA 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            G  K  E  D  C  R  L  Y  Q  A  A  D  S  C  R  *  S  Q  P  V  A  A  G  R  S  G  T  G  P  A  R  P  E    F1
          M  A  K  K  I  V  G  F  I  K  L  Q  I  P  A  G  K  A  N  P  S  P  P  V  G  P  A  L  G  Q  R  G  L  N   F2
           W  Q  R  R  L  S  A  L  S  S  C  R  F  L  Q  V  K  P  T  R  R  R  R  S  V  R  H  W  A  S  A  A  *     F3
      101 ATGGCAAAGAAGATTGTCGGCTTTATCAAGCTGCAGATTCCTGCAGGTAAAGCCAACCCGTCGCCGCCGGTCGGTCCGGCACTGGGCCAGCGCGGCCTGA 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           H  H  G  V  L  Q  G  V  Q  R  A  D  S  R  Y  G  A  G  S  A  G  A  G  R  H  H  G  I  R  *  Q  E  L     F1
            I  M  E  F  C  K  A  F  N  A  Q  T  Q  G  M  E  P  G  L  P  V  P  V  V  I  T  A  Y  A  D  K  S  F    F2
          T  S  W  S  S  A  R  R  S  T  R  R  L  K  V  W  S  R  V  C  R  C  R  S  S  S  R  H  T  L  T  R  A  S   F3
      201 ACATCATGGAGTTCTGCAAGGCGTTCAACGCGCAGACTCAAGGTATGGAGCCGGGTCTGCCGGTGCCGGTCGTCATCACGGCATACGCTGACAAGAGCTT 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          H  V  R  D  E  D  A  A  G  D  R  P  D  Q  E  G  G  E  G  G  Q  G  L  E  Q  A  A  H  R  Q  G  R  F  D   F1
           T  F  V  M  K  T  P  P  A  T  V  L  I  K  K  A  A  K  V  D  K  G  S  S  K  P  H  T  D  K  V  G  S     F2
            R  S  *  *  R  R  R  R  R  P  S  *  S  R  R  R  R  R  W  T  R  A  R  A  S  R  T  P  T  R  S  V  R    F3
      301 CACGTTCGTGATGAAGACGCCGCCGGCGACCGTCCTGATCAAGAAGGCGGCGAAGGTGGACAAGGGCTCGAGCAAGCCGCACACCGACAAGGTCGGTTCG 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            H  A  R  S  S  R  R  N  R  K  D  Q  D  A  G  P  H  G  S  *  S  G  R  S  R  S  H  H  R  W  *  R  T    F1
          I  T  R  A  Q  A  E  E  I  A  K  T  K  M  P  D  L  T  A  A  D  L  D  A  A  V  R  T  I  A  G  S  A  R   F2
           S  R  A  L  K  P  K  K  S  Q  R  P  R  C  R  T  S  R  Q  L  I  W  T  Q  P  F  A  P  S  L  V  A  H     F3
      401 ATCACGCGCGCTCAAGCCGAAGAAATCGCAAAGACCAAGATGCCGGACCTCACGGCAGCTGATCTGGACGCAGCCGTTCGCACCATCGCTGGTAGCGCAC 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           L  D  G  H  H  C  G  G  R  V  N  G  *  D  L  Q  A  P  S  G  I  C  R  Q  G  R  P  S  E  A  V  R  D     F1
            S  M  G  I  T  V  E  G  V  *  M  A  K  I  S  K  R  R  Q  A  F  A  A  K  V  D  R  Q  K  L  Y  A  I    F2
          A  R  W  A  S  L  W  R  A  C  K  W  L  R  S  P  S  A  V  R  H  L  P  P  R  S  T  V  R  S  C  T  R  S   F3
      501 GCTCGATGGGCATCACTGTGGAGGGCGTGTAAATGGCTAAGATCTCCAAGCGCCGTCAGGCATTTGCCGCCAAGGTCGACCGTCAGAAGCTGTACGCGAT 600
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          R  R  R  T  G  T  R  E  G  M  R                                                                        F1
           D  D  A  L  A  L  V  K  E  C  X                                                                       F2
            T  T  H  W  H  S  *  R  N  A                                                                         F3
      601 CGACGACGCACTGGCACTCGTGAAGGAATGCG 632
          ----:----|----:----|----:----|--