gltA allele sequence: id-1015

Contig position

sequence bin id
86
contig length
342238
start
128581
end
129009
length
429
orientation
reverse
complete
yes
method
Illumina
Options

Sequence

TATTACTGAA CTTGCTGGAA AACACTCATT TTTAGATGTT GCTTACCTTT TAATGAGAGG GAAACTTCCA ACACCAGAAG CTTCAAAAAA CTTTGATTTA GAAATAAGAC ATAGATCTTT TTTAAATGAA GGTATCATTA GATTATTTGA TGCGCTACCA GATGGTGCTC ACCCAATGGC AACTATGGGA GCAGCAACTA TGGCATTATC TGCATTTTAT AAAGACCACT TACATTTAGA AGATGAAGAT GCTTTTAAAA TGATGAGAAG AAGAATTTTA GCAAAAATGC CTGTAATTGC AGCTATGGCA TATAGAAATT CTATTGGTAC TCCACTTATT TATCCAGATG TAAATAGATA TTTCACAGAA AACTTCTTAT ATATGTTAAG AGCATATCCA GGTGGAAGAA TGAAATATTT AGGTGATGGG AAAAATCAAG AAATTACTCA AATCGAAGTT GATGCACTTG ATGCAATTTT AACTTTACAT GCTGACCATG AACAAAATGC TTCTACAACA ACAGTTAGAA ATGTTGGTTC TACTGAAGCT CACCCTTATG TAGCAATTGC TTCTGGTATC TCAGCTTTAT GGGGAAGTGC ACACGGTGGA GCAAATGAAA AAGTTATGG

Translation


          Y  Y  *  T  C  W  K  T  L  I  F  R  C  C  L  P  F  N  E  R  E  T  S  N  T  R  S  F  K  K  L  *  F  R   F1
           I  T  E  L  A  G  K  H  S  F  L  D  V  A  Y  L  L  M  R  G  K  L  P  T  P  E  A  S  K  N  F  D  L     F2
            L  L  N  L  L  E  N  T  H  F  *  M  L  L  T  F  *  *  E  G  N  F  Q  H  Q  K  L  Q  K  T  L  I  *    F3
        1 TATTACTGAACTTGCTGGAAAACACTCATTTTTAGATGTTGCTTACCTTTTAATGAGAGGGAAACTTCCAACACCAGAAGCTTCAAAAAACTTTGATTTA 100
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            N  K  T  *  I  F  F  K  *  R  Y  H  *  I  I  *  C  A  T  R  W  C  S  P  N  G  N  Y  G  S  S  N  Y    F1
          E  I  R  H  R  S  F  L  N  E  G  I  I  R  L  F  D  A  L  P  D  G  A  H  P  M  A  T  M  G  A  A  T  M   F2
           K  *  D  I  D  L  F  *  M  K  V  S  L  D  Y  L  M  R  Y  Q  M  V  L  T  Q  W  Q  L  W  E  Q  Q  L     F3
      101 GAAATAAGACATAGATCTTTTTTAAATGAAGGTATCATTAGATTATTTGATGCGCTACCAGATGGTGCTCACCCAATGGCAACTATGGGAGCAGCAACTA 200
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           G  I  I  C  I  L  *  R  P  L  T  F  R  R  *  R  C  F  *  N  D  E  K  K  N  F  S  K  N  A  C  N  C     F1
            A  L  S  A  F  Y  K  D  H  L  H  L  E  D  E  D  A  F  K  M  M  R  R  R  I  L  A  K  M  P  V  I  A    F2
          W  H  Y  L  H  F  I  K  T  T  Y  I  *  K  M  K  M  L  L  K  *  *  E  E  E  F  *  Q  K  C  L  *  L  Q   F3
      201 TGGCATTATCTGCATTTTATAAAGACCACTTACATTTAGAAGATGAAGATGCTTTTAAAATGATGAGAAGAAGAATTTTAGCAAAAATGCCTGTAATTGC 300
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          S  Y  G  I  *  K  F  Y  W  Y  S  T  Y  L  S  R  C  K  *  I  F  H  R  K  L  L  I  Y  V  K  S  I  S  R   F1
           A  M  A  Y  R  N  S  I  G  T  P  L  I  Y  P  D  V  N  R  Y  F  T  E  N  F  L  Y  M  L  R  A  Y  P     F2
            L  W  H  I  E  I  L  L  V  L  H  L  F  I  Q  M  *  I  D  I  S  Q  K  T  S  Y  I  C  *  E  H  I  Q    F3
      301 AGCTATGGCATATAGAAATTCTATTGGTACTCCACTTATTTATCCAGATGTAAATAGATATTTCACAGAAAACTTCTTATATATGTTAAGAGCATATCCA 400
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

            W  K  N  E  I  F  R  *  W  E  K  S  R  N  Y  S  N  R  S  *  C  T  *  C  N  F  N  F  T  C  *  P  *    F1
          G  G  R  M  K  Y  L  G  D  G  K  N  Q  E  I  T  Q  I  E  V  D  A  L  D  A  I  L  T  L  H  A  D  H  E   F2
           V  E  E  *  N  I  *  V  M  G  K  I  K  K  L  L  K  S  K  L  M  H  L  M  Q  F  *  L  Y  M  L  T  M     F3
      401 GGTGGAAGAATGAAATATTTAGGTGATGGGAAAAATCAAGAAATTACTCAAATCGAAGTTGATGCACTTGATGCAATTTTAACTTTACATGCTGACCATG 500
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

           T  K  C  F  Y  N  N  S  *  K  C  W  F  Y  *  S  S  P  L  C  S  N  C  F  W  Y  L  S  F  M  G  K  C     F1
            Q  N  A  S  T  T  T  V  R  N  V  G  S  T  E  A  H  P  Y  V  A  I  A  S  G  I  S  A  L  W  G  S  A    F2
          N  K  M  L  L  Q  Q  Q  L  E  M  L  V  L  L  K  L  T  L  M  *  Q  L  L  L  V  S  Q  L  Y  G  E  V  H   F3
      501 AACAAAATGCTTCTACAACAACAGTTAGAAATGTTGGTTCTACTGAAGCTCACCCTTATGTAGCAATTGCTTCTGGTATCTCAGCTTTATGGGGAAGTGC 600
          ----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|----:----|

          T  R  W  S  K  *  K  S  Y  G                                                                           F1
           H  G  G  A  N  E  K  V  M  X                                                                          F2
            T  V  E  Q  M  K  K  L  W                                                                            F3
      601 ACACGGTGGAGCAAATGAAAAAGTTATGG 629
          ----:----|----:----|----:----