getAlleleSequence

Description: Returns allele sequence based on locus and allele number.

Arguments

Sample Perl code

#!/usr/bin/perl
#Written by Keith Jolley

use SOAP::Lite;
use strict;
use warnings;

#####Sample arguments#########
my $database = 'neisseria';
my $locus = 'abcZ';
my $allele = 50;
##############################

my $soap = SOAP::Lite
    -> uri('http://pubmlst.org/MLST')
    -> proxy('http://pubmlst.org/cgi-bin/mlstdbnet/mlstFetch.pl');
my $soapResponse = $soap->getAlleleSequence($database,$locus,$allele);
unless ($soapResponse->fault){
    print $soapResponse->result()."\n";
} else {
    print join ', ',$soapResponse->faultcode,$soapResponse->faultstring;
}

Sample Java code

package org.pubmlst.mlstSOAP;

import org.apache.axis.client.Call;
import org.apache.axis.client.Service;
import javax.xml.namespace.QName;

public class GetAlleleSequence {
    public static void main(String[] args) {
	//Sample arguments////////////////
	String database = "neisseria";
	String locus = "abcZ";
	int allele = 50;
	//////////////////////////////////
	try {
	    String endpoint = "http://pubmlst.org/cgi-bin/mlstdbnet/mlstFetch.pl";
	    Service service = new Service();
	    Call call = (Call) service.createCall();
	    call.setTargetEndpointAddress(new java.net.URL(endpoint));
	    call.setOperationName(new QName("http://pubmlst.org/MLST/",
					    "getAlleleSequence"));
	    Object ret = call.invoke(new Object[] { database,locus,allele });
	    System.out.println(ret);
	} catch (Exception e) {
	    System.err.println(e.toString());
	}
    }
}

Output

TTTGATACCGTTGCCGAAGGTTTGGGTGAAATTCGCGATTTATTGCGCCGTTACCACCGC
GTCGGCCATGAGTTGGAAAACGGTTCGGGTGAGGCTTTGTTGAAAGAACTCAACGAATTA
CAACTTGAAATCGAAGCGAAGGACGGCTGGAAGCTGGATGCGGCAGTCAAGCAGACTTTG
GGGGAACTCGGTTTGCCGGAAAACGAAAAAATCGGCAACCTTTCCGGCGGTCAGAAAAAG
CGTGTCGCCTTGGCGCAGGCTTGGGTGCAGAAGCCCGACGTATTGCTGCTGGACGAGCCG
ACCAACCATTTGGATATCGACGCGATTATTTGGCTGGAAAATCTGCTCAAAGCGTTTGAA
GGCAGCTTGGTTGTGATTACCCACGACCGCCGTTTTTTGGACAATATCGCCACGCGGATT
GTCGAACTCGATC

Navigation

- PubMLST+ PubMLST
MLST Home
Search / site map
Download data
Databases
News
- Software+ Software
Web tools
Software
- Recently updated+ Recently updated
A. baumannii (Oxford)
A. baumannii (Pasteur)
Arcobacter
B. cepacia
B. hampsonii
B. hyodysenteriae
B. intermedia
B. licheniformis
B. pilosicoli
Bordetella
Brachyspira
C. albicans
C. difficile
C. jejuni
C. krusei
C. tropicalis
Chlamydiales
Cronobacter
E. faecium
H. influenzae
H. parasuis
Leptospira#2
Leptospira#3
M. plutonius
Neisseria
P. acnes
P. aeruginosa
P. multocida (RIRDC)
P. multocida (multi)
S. agalactiae
S. gallolyticus
S. maltophilia
S. pneumoniae
S. pseudintermedius
S. uberis
V. cholerae
V. parahaemolyticus
V. vulnificus
Wolbachia
- Mirrors+ Mirrors
About our mirrors Primary | DK1 | NO1 | UK2 | UK3 | UK4 | US1 | US2
- Developers+ Developers
SOAP API