Expand PubMLST Databases Downloads BIGSdb Contact Account

MLST of Acinetobacter baumannii complex (Pasteur scheme)

Genes

The Acinetobacter baumannii (and closely related species) MLST scheme uses fragments of the following seven house-keeping genes:

Primers for PCR amplification

cpn60:F:cpn60F ACTGTACTTGCTCAAGC
cpn60:F:cpn60R TTCAGCGATGATAAGAAGTGG

fusA:F:fusA7 ATCGGTATTTCTGCKCACATYGAT
fusA:R:fusA8 CCAACATACKYTGWACACCTTTGTT

gltA:F:gltAF AATTTACAGTGGCACATTAGGTCCC
gltA:R:gltAR GCAGAGATACCAGCAGAGATACACG

pyrG:F:pyrG7 GGTGTTGTTTCATCACTAGGWAAAGG
pyrG:R:pyrG8 ATAAATGGTAAAGAYTCGATRTCACCMA

recA:F:RA1 CCTGAATCTTCYGGTAAAAC
recA:R:RA2 GTTTCTGGGCTGCCAAACATTAC

rplB:F:rplB7 GTAGAGCGTATTGAATACGATCCTAACC
rplB:R:rplB8 CACCACCACCRTGYGGGTGATC

rpoB:F:Vic4 GGCGAAATGGC(AGT)GA(AG)AACCA (Please note: This primer sequence was corrected on Sept. 18th, 2009)
rpoB:R:Vic6 GA(AG)TC(CT)TCGAAGTTGTAACC

PCR amplification is performed at an annealing temperature of 50°C for all genes.

Primers for sequencing

We use the PCR primers for sequencing on both strands.

DNA Extraction

  1. Resuspend one white loop (1 µl) of 24h plate culture of bacteria in 200 µl of sterilized and free DNA water.
  2. Heat 10 min at 96 °C
  3. Centrifuge 5 min at 13000 rpm
  4. Pipette the supernatant and put it in 1.5 ml Eppendorf tube.

PCR amplification

  1. For each sample : 50 µl final volume
    • Water : 34 µl 10X Buffer : 5 µl
    • MgCl2 (25mM) : 3 µl
    • dNTP (1.25mM each) : 4 µl
    • Primer 1 (10 uM) : 1 µl
    • Primer 2 (10 uM) : 1 µl
    • Taq invitrogen (ref : 18038-026) 5 U/µl : 0.17 µl
  2. Add 2 µl of DNA (10 ng/µl) in 48 µl of mix.
  3. After the PCR cycle, migrate the PCR product (4µl of PCR product + 3 µl of blue) in a 1% agarose gel (100 ml of TBE 0.5X + 1g of agarose + 2 drops of BET).<

Cycle

94°C 2 min

94°C 30 sec
50°C 30 sec *35
72°C 30 sec

72°C 5 min

PCR purification

  1. In a 96 Millipore plate (purple), put in each well 46 µl of purified PCR product and 54 µl of sterilized and free-DNA water.
  2. Filtration over 10 min.
  3. Put 50 µl of sterilized and free -DNA water in each well of the plate.
  4. Mix on a vortex over 10 min.
  5. Transfer the purified PCR product in a plate.

Sequence reaction

  1. Mix preparation for one reaction (one strain, one gene, one primer)
    • Water : 5 µl
    • 5X Buffer : 1 µl
    • Primer (4µM) : 1 µl
    • BigDye V1.1 : 1 µl
  2. Put 2 µl of purified PCR product in 8 µl of mix.
  3. Sequence cycling.

Sequence purification

  1. To each well of the plate, add 1 µl of sodium acetate 3M, 1 µl of EDTA 125 mM and 50 µl of 95 % ethanol
  2. Turn down the plate 10 times
  3. Centrifuge 30 min at 3300 rpm
  4. Throw out the supernatant
  5. Return the plate on a paper and centrifuge it 1 min at 1000 rpm
  6. Add 50 µl of 70 % ethanol
  7. Centrifuge 15 min at 3300 rpm
  8. Throw out the supernatant
  9. Return the plate on a paper and centrifuge it 1 min at 1000 rpm
  10. Dry the plate on the lab table over 15 min
  11. Conserve the plate at -20°C

Allele templates

cpn60(405 bp)

ATGAACCCAA TGGATTTAAA ACGCGGTATC GACATTGCAG TAAAAACTGT AGTTGAAAAT ATCCGTTCTA TTGCTAAACC AGCTGATGAT TTCAAAGCAA TTGAACAAGT AGGTTCAATC TCTGCTAACT CTGATACTAC TGTTGGTAAA CTTATTGCTC AAGCAATGGA AAAAGTAGGT AAAGAAGGCG TAATCACTGT AGAAGAAGGT TCTGGCTTCG AAGACGCATT AGACGTTGTA GAAGGTATGC AGTTTGACCG TGGTTATATC TCTCCGTACT TTGCAAACAA ACAAGATACT TTAACTGCTG AACTTGAAAA TCCGTTCATT CTTCTTGTTG ATAAAAAAAT CAGCAACATT CGTGAATTGA TTTCTGTTTT AGAAGCAGTT GCTAAAACTG GTAAA

fusA (633 bp)

ATTGGTGAAG TACACGACGG TGCAGCAACA ATGGACTGGA TGGAACAAGA GCAAGAGCGT GGTATTACAA TTACCTCTGC TGCAACAACT TGTTTCTGGT CTGGTATGGG TAACCAATTC CCACAACACC GTATCAACGT AATTGATACA CCGGGACACG TTGACTTCAC AATCGAAGTT GAGCGTTCTA TGCGTGTTCT TGACGGTGCT TGCATGGTTT ACTGTGCAGT TGGTGGTGTA CAGCCTCAGT CTGAAACTGT ATGGCGTCAG GCTAACAAAT ATAAAGTGCC TCGTTTAGCA TTCGTGAACA AGATGGACCG TACTGGTGCA AACTTCTTCC GTGTTGTTGA ACAAATGAAA ACACGTCTTG GTGCGAATCC TGTGCCAATC GTTGTGCCAA TCGGTGCTGA AGACACATTC ACTGGTGTAG TTGACCTTAT CGAAATGAAG GCAATTATCT GGGATGAAGC TTCTCAAGGT ATGAAGTTTG AATACGGCGA GATTCCAGCT GACCTAGTTG ATACTGCTCA AGAATGGCGT ACAAACATGG TTGAAGCTGC TGCTGAAGCT TCTGAAGAGT TAATGGACAA GTACCTTGAA GAGGGTGATC TTTCTAAAGA AGACATCATC GCA

gltA (483 bp)

GATCCTGGTT TTATGGCGAC AGCTTCATGC GAGTCTAAAA TCACATTTAT CGATGGTGAC AAAGGTATTT TATTACACCG CGGTTACCCG ATTGACCAGT TAGCGACTCA AGCAGACTAC CTTGAAACTT GTTATTTATT ATTAAATGGC GAGTTACCAA CTGCTGAACA AAAAGTTGAG TTCGATGCGA AAGTTCGTGC TCATACTATG GTTCATGATC AAGTTAGCCG TTTCTTCAAT GGTTTCCGTC GTGATGCTCA CCCTATGGCA ATCATGGTTG GTGTAGTAGG CGCATTATCT GCTTTCTATC ACAACAACCT TGACATTGAA GACATCAATC ACCGCGAAAT TACTGCGATT CGTTTGATTG CTAAAATTCC AACGCTTGCT GCTTGGAGCT ACAAATATAC TGTAGGTCAG CCATTCATCT ATCCACGTAA TGACTTAAAT TATGCGGAAA ACTTCTTACA CATGATGTTT GCA

pyrG (297 bp)

AAAGTCACAA TGGTTAAAAT GGATCCTTAT ATTAATGTCG ATCCAGGGAC AATGAGCCCA TTCCAGCATG GTGAAGTTTT TGTTACCGAA GATGGTGCAG AAACAGATCT GGATCTGGGT TATTACGAAC GTTTCTTACG TCGCGCGAAA ATGACCAAAC TAAACAACTT CACTAGTGGT CGTGTATATC AAGACGTTTT AAATAAAGAG CGTCGTGGTG ATTACTTAGG TGGTACAGTT CAGGTTATTC CTCATATTAC CGACAATATT AAAGAACGTG TACTCCGCGC AGGCGAA

recA (372 bp)

TTACAAGCAA TTGCTCAATG TCAAAAATCT GGTGGTACAT GTGCCTTCAT TGATGCTGAG CACGCCCTAG ACCCTCAATA TGCACGCAAA CTTGGTGTAG ATATTGATAA CCTACTTGTT TCACAACCCG ACAATGGTGA GCAAGCACTT GAAATTGCTG ACATGCTTGT CCGTTCAGGC GCAATTGATT TAATCGTTGT GGACTCGGTG GCTGCACTTA CGCCTAAAGC AGAAATCGAA GGTGAGATGG GTGACTCTCA TATGGGTCTA CAAGCGCGTC TTATGAGCCA GGCACTTCGT AAAATTACGG GTAATGCTAA ACGTTCAAAC TGTATGGTTA TCTTCATTAA CCAGATTCGT ATGAAAATTG GT

rplB (330 bp)

CGTCGTTATA TCATTGCGCC TAAAGGCTTA CGTGCTGGTG ATAAAGTACA ATCTGGTAAC GATGCTCCAA TTCGTCCAGG TAACTGTTTA CCACTTCGTA ACATGCCAAT CGGTTCTACA CTTCATAACG TTGAACTTAA AATCGGTAAA GGTGCTCAAT TAGCACGTTC TGCTGGTGCT TCTGTTCAAT TGTTGGGTCG TGATGGTTCT TACGCAATCA TTCGTCTTCG TTCAGGCGAA ATGCGTAAAG TACACGTTGA ATGCCGCGCT GTAATTGGTG AAGTTTCTAA CCAAGAAAAC AACCTTCGCT CATTAGGTAA AGCTGGTGCT

rpoB (456 bp)

CAAACTCACT ATGGTCGTGT TTGTCCAATT GAAACTCCTG AAGGTCCAAA CATTGGTTTG ATCAACTCGC TTTCTGTATA CGCAAAAGCG AATGACTTCG GTTTCTTGGA AACTCCATAC CGCAAAGTTG TAGATGGTCG TGTAACTGAT GATGTTGAAT ATTTATCTGC AATTGAAGAA GTAGGCACTG TTATTGCACA GGCCGACTCT GCAGTAGATA AAGATGGCAA CTTAACAGAA GAATTCGTTT CTGTTCGTCA TCAAGGTGAA TTCGTACGTA TGCCGCCTGA AAAAGTAACG CATATGGACG TTTCTGCACA GCAGGTAGTA TCTGTTGCTG CATCACTTAT TCCATTCCTT GAACACGATG ACGCAAACCG TGCGCTCATG GGTTCAAACA TGCAACGTCA GGCAGTTCCT ACTTTACGTG CGGATAAACC GCTTGTAGGT ACAGGT

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Acinetobacter baumannii MLST website (https://pubmlst.org/ abaumannii/) sited at the University of Oxford (Jolley et al. Wellcome Open Res 2018, 3:124 [version 1; referees: 2 approved]). The development of this site has been funded by the Wellcome Trust.

Status

Sequence database
Sequences: 2,704
Profiles:
MLST (Oxford): 1,974
MLST (Pasteur): 1,342

Isolate database
Isolates: 4,208
Last updated: 2019-08-31