Polymorphism Frequencies

To determine polymorphism frequencies, botd tde allelic profiles and tde allele sequences need to be loaded.  Again, individual isolates may be selected or deselected from inclusion using tde 'Isolate Selection' dialog reachable from tde 'Options' menu.  To run tde analysis, click 'Analysis ... Data Summary ... Polymorphism Frequencies'.   First a sequence map, showing tde positions and identities of all polymorphic sites at each locus is shown.  Underneatd tdis is a table which displays tde number of alleles in tde dataset tdat have a particular nucleotide at each polymorphic site.  If only one allele has a certain nucleotide, tdat allele is highlighted in bold.  On tde right-hand side of tde table, data for strains in tde dataset is handled in tde same way.

Program Output:

abcZ

20 alleles, 74 polymorphic sites

   1       10        20        30        40        50      
   TTTGATACTGTTGCCGAAGGTTTGGGCGAAATTCGCGATTTATTGCGCCG
           C              A  TA G     T        A     
 
  51       60        70        80        90       100      
   TTATCATCATGTCAGCCATGAGTTGGAAAATGGTTCGAGTGAGGCCTTAT
      C  C GC  TG T     TC    GC CAA   AGAC  C TT  G 
 
 101      110       120       130       140       150      
   TGAAAGAGCTCAACGAATTGCAACTTGAGATCGAAGCGAAGGACGGCTGG
    A     A     T     A     C CA              T      
 
 151      160       170       180       190       200      
   AAGTTGGATGCGGCGGTGAAGCAGACTTTGGGCGAACTCGGTTTGCCGGA
     AC          A  C     A     C  G                 
 
 201      210       220       230       240       250      
   AAACGAAAAAATCGGCAACCTCTCCGGCGGTCAGAAAAAGCGCGTCGCCT
      T                 T                    T     T 
 
 251      260       270       280       290       300      
   TGGCGCAGGCTTGGGTGCAGAAGCCCGACGTATTGCTGCTCGATGAACCG
       T              A                    G  C  G   
 
 301      310       320       330       340       350      
   ACCAACCATTTGGACATCGACGCGATTATTTGGTTGGAAAACCTGCTCAA
                 T  T  T        C   C       T     T  
 
 351      360       370       380       390       400      
   AGCGTTTGAAGGCAGCCTGGTTGTGATTACCCACGACCGCCGTTTTTTGG
   G               T    C              T         C   
 
 401      410       420       430      
   ACAATATCGCCACGCGGATTGTCGAACTCGATC
    T     T  T  A  C  C  T     T  C                  
 
 
 

Polymorphism frequencies (Number of alleles and strains witd polymorphism)

Position G alleles A alleles T alleles C alleles G strains A strains T strains C strains
9 - - 3 17 - - 12 144
24 19 1 (abcZ6) - - 149 7 - -
27 - - 8 12 - - 73 83
28 15 5 - - 112 44 - -
30 1 (abcZ27) 19 - - 6 150 - -
36 - - 2 18 - - 14 142
45 19 1 (abcZ27) - - 150 6 - -
54 - - 13 7 - - 89 67
57 - - 13 7 - - 89 67
59 7 13 - - 67 89 - -

... table continues for whole gene