Expand PubMLST Databases Downloads BIGSdb Contact Site map

Primers used for MLST of Pseudomonas aeruginosa

Genes

The Pseudomonas aeruginosa MLST scheme uses internal fragments of the following seven house-keeping genes:

acsA (Acetyl coenzyme A synthetase)
aroE (Shikimate dehydrogenase)
guaA (GMP synthase)
mutL (DNA mismatch repair protein)
nuoD (NADH dehydrogenase I chain C, D)
ppsA (Phosphoenolpyruvate synthase)
trpE (Anthralite synthetase component I)

PCR Amplification

Reaction conditions for all the primers were as follows: initial denaturation at 96°C for 1 min; 30 cycles of denaturation at 96°C for 1 min, primer annealing at 55°C for 1 min, extension at 72°C for 1 min; followed by a final extension step of 72°C for 10 min. Each 50 µl amplification reaction mixture comprised 2.0 µl chromosomal DNA (5-20 ng/µl), 2.0 µl forward primer (10 pmol/µl), 2.0 µl reverse primer (10 pmol/µl), 5.0 µl 10x PCR buffer (Qiagen, contains 15 mM MgCl2), 1.0 µl dNTP solution (Qiagen, 10 mM each dNTP), 0.25 µl Taq polymerase (Qiagen, 5units/µl) and 37.75 µl PCR-grade water. All Qiagen solutions from PCR CORE Kit (Cat No. 201225).

The amplification product was then purified using MinElute UF plates (Qiagen) following the manufacturers protocol before being used in a sequencing reaction. Sequencing was carried out on each DNA strand with BigDye Terminator Ready Reaction Mix v3.1 (PE Biosystems, Foster City, US) under the following conditions: initial denaturation at 96°C for 1 min, 30 cycles of 10 sec at 96°C, 5 sec at 51°C and 2 min at 60°C. Unincorporated dye terminators were removed by precipitation with 95% alcohol. The reaction products were separated and detected on an ABI PRISM genetic analyser 3100 (PE Biosystems) using a standard sequencing module with a Performance Optimised Polymer and 5 cm array.

See Curran et al, J Clin Microbiol 2004, 42:5644-9 for further details.

The primer pairs we use for the PCR amplification of internal fragments of these genes are:

acsA-F   ACCTGGTGTACGCCTCGCTGAC
acsA-R   GACATAGATGCCCTGCCCCTTGAT

aroE-F   TGGGGCTATGACTGGAAACC
aroE-R   TAACCCGGTTTTGTGATTCCTACA

guaA-F   CGGCCTCGACGTGTGGATGA
guaA-R   GAACGCCTGGCTGGTCTTGTGGTA

mutL-F   CCAGATCGCCGCCGGTGAGGTG
mutL-R   CAGGGTGCCATAGAGGAAGTC

nuoD-F   ACCGCCACCCGTACTG
nuoD-R   TCTCGCCCATCTTGACCA

ppsA-F   GGTCGCTCGGTCAAGGTAGTGG
ppsA-R   GGGTTCTCTTCTTCCGGCTCGTAG

trpE-F   GCGGCCCAGGGTCGTGAG
trpE-R   CCCGGCGCTTGTTGATGGTT

Sequencing

We use the following primer pairs for sequencing:

acsA-F   GCCACACCTACATCGTCTAT
acsA-R   AGGTTGCCGAGGTTGTCCAC

aroE-F   ATGTCACCGTGCCGTTCAAG
aroE-R   TGAAGGCAGTCGGTTCCTTG

guaA-F   AGGTCGGTTCCTCCAAGGTC
guaA-R   GACGTTGTGGTGCGACTTGA

mutL-F   AGAAGACCGAGTTCGACCAT
mutL-R   GGTGCCATAGAGGAAGTCAT

nuoD-F   ACGGCGAGAACGAGGACTAC
nuoD-R   TGGCGGTCGGTGAAGGTGAA

ppsA-F   GGTGACGACGGCAAGCTGTA
ppsA-R   GTATCGCCTTCGGCACAGGA

trpE-F   TTCAACTTCGGCGACTTCCA
trpE-R   GGTGTCCATGTTGCCGTTCC 

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Pseudomonas aeruginosa MLST website (http://pubmlst.org/ paeruginosa/) developed by Keith Jolley and sited at the University of Oxford (Jolley & Maiden 2010, BMC Bioinformatics, 11:595). The development of this site has been funded by the Wellcome Trust.

Status

Sequence database
Sequences: 1603
Profiles (MLST): 1928
Last updated: 2014-09-01

Isolate database
Isolates: 2428
Last updated: 2014-09-01