Expand PubMLST Databases Downloads BIGSdb Contact Site map

Primers used for MLST of Helicobacter pylori


The Helicobacter MLST scheme uses internal fragments of the following seven house-keeping genes:

atpA, efp, mutY, ppa, trpC, ureI, yphC


The primer pairs we use for the PCR amplification of internal fragments of these genes are:

Number Name Gene Sequence
O_2357 atpAinternal-for atpA internal GCTATTGGGCAAAAAGAATC
O_2358 atpAinternal-rev atpA internal ACGACGCTGTATTCCATCGC

Primer combinations

Amplification Sequencing
Gene fragment for rev for rev
atpA O_1964 O_1965 O_1964 O_1965
internal atpA O_2357 O_2358
efp O_2044 O_2045 O_2044 O_2045
mutY O_1979 O_1982 O_1979 O_1982
ppa O_3238 O_3241 O_3238 O_3241
trpC O_1370 O_1372 O_1370 O_1372
ureI O_2356 O_3151 O_2356 O_3151
yphC O_1960 O_1963 O_1960 O_1963
vacA O_1514 O_1493 O_1514 O_1493

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Helicobacter pylori Multi Locus Sequence Typing website (http://pubmlst.org/ helicobacter/) developed by Keith Jolley and sited at the University of Oxford (Jolley & Maiden 2010, BMC Bioinformatics, 11:595). The development of this site has been funded by the Wellcome Trust and European Union.


Sequence database
Sequences: 19340
Profiles (MLST): 3137
Last updated: 2017-02-02

Isolate database
Isolates: 2225
Last updated: 2016-12-07