Expand PubMLST Databases Downloads BIGSdb Contact Site map

Primers used for MLST of Campylobacter

Genes

The Campylobacter MLST scheme uses internal fragments of the following seven house-keeping genes:

aspA (aspatase)
glnA (glutamine synthetase)
gltA (citrate synthase)
glyA (serine hydroxy methyl transferase)
pgm (phospho glucomutase)
tkt (transketolase)
uncA (ATP synthase alpha subunit)

C. jejuni

PCR Amplification

The primer pairs used for the PCR amplification of internal fragments of these genes (approx. 1kb) are shown below.  Separate nested primer pairs are used to sequence 400-500 bp fragments.

The primers have been designed using experience gained during the amplification and sequencing of around 750 isolates.  The isolates are human, animal and environmental in origin, and represent the most diverse range of specimens we could obtain.  Due to sequence variation between Campylobacter isolates, alternative primers are sometimes suggested.  When a choice of primers is given, the primer pair we have found to give the best results is indicated by *.

aspA
Forward
A1 AAAGCTGCAGCTATGGC
A3 ATGAGGTTTATTATGGAGTGC
A9 AGTACTAATGATGCTTATCC*
Reverse
A2 AAGCGCAATATCAGCCACTC
A4 CCTCTTTGGCTATAGAAGCTG
A10 ATTTCATCAATTTGTTCTTTGC*

glnA
Forward
A1 TAGGAACTTGGCATCATATTACC
Reverse
A2 TTGGACGAGCTTCTACTGGC

gltA
Forward
A1 GGGCTTGACTTCTACAGCTACTTG
Reverse
A2 CCAAATAAAGTTGTCTTGGACGG

glyA
Forward
A1 GAGTTAGAGCGTCAATGTGAAGG
Reverse
A2 AAACCTCTGGCAGTAAGGGC

tkt
Forward
A1 TTTAAGTGCTGATATGGTGC
A3 GCAAACTCAGGACACCCAGG*
Reverse
A4 CATAGCGTGTTCTCTGATACC
A6 AAAGCATTGTTAATGGCTGC*

pgm
Forward
A1 TTGGAACTGATGGAGTTCG
A3 TCAGGGCTTACTTCTATAGG
A7 TACTAATAATATCTTAGTAGG*
Reverse
A2 AAGAGCTTAATATCTCTGGCTTCTAG
A4 AGCTTAATATCTCTGGCTTC
A8 CACAACATTTTTCATTTCTTTTTC*

uncA
Forward
A3 AAAGCTGATGAGATCACTTC
A7 ATGGACTTAAGAATATTATGGC-3*
Reverse
A2 GCTAAGCGGAGAATAAGGTGG
A4 ATTCTTTGTCCACGTTCAAG
A8 ATAAATTCCATCTTCAAATTCC*

Reaction conditions - PCR

Denaturation: 94ºC 2 minutes
Annealing: 50ºC 1 minute
Extension: 72º C 1 minute
35 cycles

Sequencing

The following primers are used for sequencing, and are nested inside the PCR primers to give approximately 600 bases of sequence data. This sequence data is then assembled and "chopped" to the correct length. If alternative primers are suggested, their locations are very close together. The same region of the gene is used for the mlst allele in all isolates.  You can download the alleles found to date here.

* The most successful primers (on our isolates).
** Designed by Jonas Waldenström (Lund University, Sweden) for use with a subset of isolates from wild birds where the standard primers were less successful.

aspA
Forward
S3 CCAACTGCAAGATGCTGTACC
Reverse
S6 TTCATTTGCGGTAATACCATC

glnA
Forward
S1 GCTCAATTCATGGATGGC
S3 CATGCAATCAATGAAGAAAC*
Reverse
S4 GCATACCATTGCCATTATCTCCG
S6 TTCCATAAGCTCATATGAAC*

gltA
Forward
S1 GTGGCTATCCTATAGAGTGGC
S3 CTTATATTGATGGAGAAAATGG*
Reverse
S6 CCAAAGCGCACCAATACCTG*
S8 TGCTATACAGGCATAAGGATG

glyA
Forward
S3 AGCTAATCAAGGTGTTTATGCGG
S5 GCTAATCAAGGTGTTTATAT**
S7 AGCCTAATTCAGGTTCTCAA**
Reverse
S4 AGGTGATTATCCGTTCCATCGC

pgm
Forward
S3 GCTTATAAGGTAGCACCTACTG
S5 GGTTTTAGATGTGGCTCATG*
Reverse
S2 TCCAGAATAGCGAAATAAGG*

tkt
Forward
S1 TGCACCTTTGGGCTTAGC
S5 GCTTAGCAGATATTTTAAGTG*
Reverse
S4 ACTTCTTCACCCAAAGGTGCG
S6 AAGCCTGCTTGTTCTTTGGC*

uncA
Forward
S3 AAAGTACAGTGGCACAAGTGG*
S5 TGTTGCAATTGGTCAAAAGC
Reverse
S4 TGCCTCATCTAAATCACTAGC*

C. coli

The same primers are used for both amplification and sequencing:

Aspcoli S1 5'-CAACTTCAAGATGCAGTACC-3'
Aspcoli S2 5'-ATCTGCTAAAGTATGCATTGC-3'

Glncoli S1 5'-TTCATGGATGGCAACCTATTG-3'
Glncoli S2 5'-GCTTTGGCATAAAAGTTGCAG-3'

Gltcoli S1 5'-GATGTAGTGCATCTTTTACTC-3'
Gltcoli S2 5'-AAGCGCTCCAATACCTGCTG-3'

Glycoli S1 5'-TCAAGGCGTTTATGCTGCAC-3'
Glycoli S2 5'-CCATCACTTACAAGCTTATAC-3'

Pgmcoli S1 5'-TTATAAGGTAGCTCCGACTG-3'
Pgmcoli S2 5'-GTTCCGAATAGCGAAATAACAC-3'

Tktcoli S1 5'-AGGCTTGTGTTTTCAGGCGG-3'
Tktcoli S2 5'-TGACTTCCTTCAAGCTCTCC-3'

Unccoli S1 5'-AAGCACAGTGGCTCAAGTTG-3'
Unccoli S2 5'-CTACTTGCCTCATCCAATCAC-3'

Any feedback/questions concerning the performance of these primers is very welcome. Please email Dr. Kate Dingle

Citing the database

The preferred format for citing this website in publications is:

This publication made use of the Campylobacter Multi Locus Sequence Typing website (http://pubmlst.org/ campylobacter/) developed by Keith Jolley and sited at the University of Oxford (Jolley & Maiden 2010, BMC Bioinformatics, 11:595). The development of this site has been funded by the Wellcome Trust.

Status

jejuni/coli

Sequence database
Sequences: 370218
Profiles (MLST): 7428
Last updated: 2014-10-30

Isolate database
Isolates: 30811
Last updated: 2014-10-30

Non-jejuni/coli

Sequence database
Sequences: 2003
Profiles:
C. concisus/curvus MLST: 124
C. helveticus MLST: 8
C. hyointestinalis MLST: 109
C. insulaenigrae MLST: 43
C. lanienae MLST: 69
C. lari MLST: 18
C. sputorum MLST: 16
C. upsaliensis MLST: 155

Isolate database
Isolates: 236
Last updated: 2013-08-23